ID: 1025304365

View in Genome Browser
Species Human (GRCh38)
Location 7:57842910-57842932
Sequence TGCTCTCAGGCTGCACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025304358_1025304365 12 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data
1025304356_1025304365 25 Left 1025304356 7:57842862-57842884 CCTCAATATTGTACCTACCGTAC No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data
1025304361_1025304365 1 Left 1025304361 7:57842886-57842908 CCTAGGCTCTATGGCACAGCCTA No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data
1025304360_1025304365 8 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304365 Original CRISPR TGCTCTCAGGCTGCACACCT GGG Intergenic
No off target data available for this crispr