ID: 1025304366

View in Genome Browser
Species Human (GRCh38)
Location 7:57842916-57842938
Sequence CAGGCTGCACACCTGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025304360_1025304366 14 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG No data
1025304361_1025304366 7 Left 1025304361 7:57842886-57842908 CCTAGGCTCTATGGCACAGCCTA No data
Right 1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG No data
1025304358_1025304366 18 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304366 Original CRISPR CAGGCTGCACACCTGGGCAC AGG Intergenic
No off target data available for this crispr