ID: 1025304374

View in Genome Browser
Species Human (GRCh38)
Location 7:57843060-57843082
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 7, 1: 0, 2: 2, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304374 Original CRISPR TAGACATGGTGCACTGGTCT AGG Intergenic
901125950 1:6928788-6928810 TAGACAGGGTGCTCTTGGCTGGG - Intronic
901941162 1:12663007-12663029 TAGACCTGGTGCACGGGCCAGGG + Intronic
902369440 1:15996546-15996568 TAGAGATGGTGCACCTGTATAGG + Intergenic
906446784 1:45906868-45906890 TAGAAATGGTACACTTGTATAGG - Intronic
914454494 1:147823293-147823315 TAGACATGGGGCACTGTACAGGG - Intergenic
916421827 1:164645012-164645034 TAAACATGGTGCATTGGGCACGG + Intronic
917466628 1:175283540-175283562 TGGATATGCTGCACTGGTCAAGG - Intergenic
923199319 1:231696007-231696029 AAGACAAGGGGCACTGGTTTAGG - Intronic
1064562145 10:16604282-16604304 TAGTCGAGGCGCACTGGTCTGGG - Intronic
1071497629 10:86179716-86179738 TAGACATGATGCACTGGTTTGGG - Intronic
1073718591 10:106139008-106139030 TAGACATTCTGCATTTGTCTGGG + Intergenic
1075434102 10:122419561-122419583 TGAACCTGGTGCACTGTTCTGGG + Intronic
1075671755 10:124267937-124267959 TTGGAAGGGTGCACTGGTCTGGG - Intergenic
1078600824 11:12728896-12728918 TAGCCATGGTCCAATGGTTTGGG - Intronic
1078692604 11:13597085-13597107 AAGACATGTTACACTTGTCTTGG - Intergenic
1079388066 11:19998318-19998340 TGGCCATGGTGCAGGGGTCTAGG + Intronic
1079513128 11:21234443-21234465 CAATCATGGTGCACTGGTCAGGG - Intronic
1080005094 11:27398219-27398241 TAAATATGGGGCACTGGTCAAGG + Intronic
1083285268 11:61654700-61654722 AAGAGATGGTGCGCTGGGCTGGG - Intergenic
1083538407 11:63492424-63492446 TAAAAATGGTGCTATGGTCTGGG + Intergenic
1084119956 11:67063094-67063116 CAAACATGGGGCACTGGGCTGGG + Intronic
1088008380 11:104969551-104969573 CAGAGATGGTGCACTGGGCTGGG - Intergenic
1088017885 11:105082108-105082130 CAGAGATGGTGCAGTGGGCTGGG - Intronic
1089576341 11:119447158-119447180 TCAACATGGTGCTCTGGTCCTGG - Intergenic
1091212600 11:133874964-133874986 TAGGCATGGTTCATAGGTCTAGG + Intergenic
1091419239 12:320935-320957 GTGACATGGTCCACTGTTCTGGG - Intronic
1098646131 12:72903617-72903639 TAGGCATCATGCTCTGGTCTGGG + Intergenic
1106675190 13:31950948-31950970 TAGAGATGGGGGTCTGGTCTGGG + Intergenic
1120266255 14:82254197-82254219 TAGAGAAAGAGCACTGGTCTTGG - Intergenic
1124941047 15:34218423-34218445 TAGACATTGTGAAATGGTATAGG + Intergenic
1131149001 15:90035226-90035248 GAGACATGAGGCAATGGTCTTGG + Intronic
1133525828 16:6604228-6604250 TAGACATGGTGCACCTATCATGG - Intronic
1134781706 16:16904131-16904153 TGGGAATGGTGCACTGGTTTTGG + Intergenic
1141745778 16:85925359-85925381 TAGACAGGGTACAGTGGTGTTGG + Intergenic
1143134145 17:4701551-4701573 TAGATATGGAGCACTGTGCTAGG + Intronic
1143338119 17:6188792-6188814 GAGACGTGATGCACAGGTCTGGG - Intergenic
1145269210 17:21395814-21395836 TAGAGGTTGTGCACTGGCCTGGG + Intronic
1145416565 17:22718100-22718122 TAGACATGGTGCACTGGTCTAGG - Intergenic
1148677082 17:49451776-49451798 GAGACAGGCTGGACTGGTCTGGG - Intronic
1152475873 17:80517912-80517934 TACACATGGTCTACAGGTCTAGG - Intergenic
1153702612 18:7711618-7711640 TTGACATGGGACACTGGACTTGG + Intronic
1157098119 18:44705727-44705749 TATACATGGTCCACTGCTTTGGG + Intronic
1159242535 18:65760823-65760845 TGGACATGGTGCACTAGTGTAGG - Intronic
1163523926 19:17808772-17808794 TGGACATCCAGCACTGGTCTGGG - Intronic
925029496 2:638223-638245 TAAACATGGTGCACCTGTATAGG + Intergenic
925511308 2:4628571-4628593 TATAAATGGAGAACTGGTCTTGG - Intergenic
925624227 2:5826110-5826132 TAGACATGGTGCTCTTCACTGGG + Intergenic
927454528 2:23238085-23238107 CAGACATGGTGCACAGGTCTAGG + Intergenic
927659002 2:24976139-24976161 TTGACTTGGTCAACTGGTCTAGG + Intergenic
930838900 2:55824910-55824932 CAGACAAGGTCCACTGGCCTGGG + Intergenic
937431682 2:121844042-121844064 GAGACGTGGTGCACAGCTCTAGG - Intergenic
938318422 2:130345858-130345880 CCGACATGGTGCCCAGGTCTGGG - Exonic
941136361 2:161722698-161722720 CAGAGCTGGTGCACTGCTCTGGG + Intronic
941733700 2:168948576-168948598 CAGACATGGTGCTGTGGACTGGG - Intronic
941865797 2:170333014-170333036 TAGTCATGGTGAACTGCTTTGGG + Intronic
946816482 2:223583549-223583571 TAAACATGGTACACTTGTATAGG - Intergenic
947311517 2:228808838-228808860 TAGAGCTGGTGCACTGTGCTGGG + Intergenic
947545687 2:231008643-231008665 TAGACATGGTGGAAGGGACTGGG + Intronic
1169187480 20:3630878-3630900 TAGACATGGTTAACTTGTCCTGG - Intronic
1171519875 20:25767488-25767510 TAGACATGGTGCACTGGTCTAGG - Intronic
1171557044 20:26089005-26089027 TAGACATGGTGCACTGGTCTAGG + Intergenic
1176654013 21:9573777-9573799 TAGACATGGTGCACTGGTCTAGG - Intergenic
1184227140 22:43135560-43135582 TAGACTGGGTGCACCTGTCTGGG + Intronic
957704848 3:83767510-83767532 TAGCAATGGTGCAATAGTCTAGG - Intergenic
965900838 3:173639523-173639545 TAGACATGGAGGACTGTTATGGG + Intronic
975382411 4:73716805-73716827 GAGAGTGGGTGCACTGGTCTGGG - Intergenic
979507370 4:121513867-121513889 TAGCCAGGATTCACTGGTCTAGG - Intergenic
983916482 4:173297734-173297756 TAGGCATGCTGAACTAGTCTTGG + Intronic
991451465 5:66755168-66755190 TAGAAATGGTGAAGTGATCTTGG + Intronic
993859606 5:93119114-93119136 TGGAAATGGTGGACTGGTCCTGG - Intergenic
996311126 5:122107177-122107199 TAGCCATGGTGCTCTAGACTGGG + Intergenic
997599270 5:135128170-135128192 TAGGCATGGGGCAATGGGCTAGG - Intronic
999178081 5:149646147-149646169 TAGACATGGTGCCAGGCTCTGGG - Intergenic
1001685607 5:173592783-173592805 CAGCCATGGTGCCCTGATCTTGG + Intergenic
1003051007 6:2781359-2781381 CAGACATGTTGCACTGGGGTGGG - Intronic
1003231989 6:4262498-4262520 TAGAGATGGTGGACTGTCCTGGG + Intergenic
1003260056 6:4508928-4508950 GAGACATGGTGAACTGGTGAGGG - Intergenic
1006909480 6:37554879-37554901 CAGACCTGGCGCACTGGCCTGGG - Intergenic
1009787977 6:68362878-68362900 TATTCATGGAGAACTGGTCTTGG - Intergenic
1010194903 6:73229530-73229552 TTGCAATGGTGCAGTGGTCTCGG + Intronic
1012252248 6:96992058-96992080 CAGACATGGCCCACTGGCCTGGG - Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1022857497 7:34329809-34329831 TACACATGGAGCATGGGTCTTGG + Intergenic
1023151641 7:37207099-37207121 AAGCCATGGTGCACAGGTCTTGG + Intronic
1025280359 7:57622441-57622463 TAGACATGGTGCACTGGTCTAGG - Intergenic
1025304374 7:57843060-57843082 TAGACATGGTGCACTGGTCTAGG + Intergenic
1038415786 8:27394463-27394485 AAAAAATGGTGCACCGGTCTAGG + Intronic
1039113652 8:34068103-34068125 TAGATATGGGTCACTGGTCTGGG - Intergenic
1041333521 8:56754035-56754057 TAGAGGTGGTGCAGTGGTATTGG + Intergenic
1047112065 8:121801725-121801747 TTCACATGGTGCACTGGACAAGG - Intergenic
1047644578 8:126856533-126856555 GTGACATGCTGCACGGGTCTAGG + Intergenic
1049339050 8:142102150-142102172 GATGCATGGTGCACAGGTCTGGG + Intergenic
1050495806 9:6240583-6240605 TAAAAATGGTGCACTTGTATTGG + Intronic
1053856430 9:42343239-42343261 TAGGCATGGAGCATTTGTCTGGG - Intergenic
1056050418 9:82762580-82762602 TAGTCAAGGTGCACTGGGCTGGG - Intergenic
1056566082 9:87773514-87773536 CAGACCTGGTGGACTGCTCTAGG + Intergenic
1058625002 9:106925706-106925728 TACACATGGTGCATTTGTATGGG - Exonic
1060714596 9:125912017-125912039 TAGTCATGGTCCAGTGGGCTTGG + Intronic
1060772205 9:126340504-126340526 CAGGCATGGTGGACTGGTCCTGG - Exonic
1203631733 Un_KI270750v1:77229-77251 TAGACATGGTGCACTGGTCTAGG - Intergenic
1190954173 X:55175428-55175450 TATACATGAGGCACTGGTCTTGG - Intronic
1192065227 X:67878027-67878049 CAGACATTGTTCCCTGGTCTTGG - Intergenic
1192067793 X:67904422-67904444 TAGAAATGCTGCACTGTGCTAGG + Intergenic
1192399380 X:70818816-70818838 CAGACATTGTGGACTGGTTTTGG - Intronic
1192494410 X:71605544-71605566 TAGAGAAGTTGCACTGGGCTTGG + Intronic
1193874737 X:86848629-86848651 TAGACATTGGACATTGGTCTAGG - Intergenic
1194131133 X:90083869-90083891 ATGACAGGGTGCACTGGTTTGGG + Intergenic
1195771419 X:108355383-108355405 CAGACAAGGTGCACTGGCTTTGG + Intronic
1198524051 X:137482229-137482251 TATAAATGGTGCACTGTTCGAGG + Intergenic
1199603960 X:149561727-149561749 TAGACCTGATTCAGTGGTCTGGG + Intergenic
1199646429 X:149917747-149917769 TAGACCTGATTCAGTGGTCTGGG - Intergenic