ID: 1025305793

View in Genome Browser
Species Human (GRCh38)
Location 7:57853406-57853428
Sequence TATTATCTTTAGAAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025305793_1025305794 6 Left 1025305793 7:57853406-57853428 CCATAAAACTTCTAAAGATAATA No data
Right 1025305794 7:57853435-57853457 AACTACCTCAATAGCCCCAGTGG No data
1025305793_1025305795 7 Left 1025305793 7:57853406-57853428 CCATAAAACTTCTAAAGATAATA No data
Right 1025305795 7:57853436-57853458 ACTACCTCAATAGCCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025305793 Original CRISPR TATTATCTTTAGAAGTTTTA TGG (reversed) Intergenic
No off target data available for this crispr