ID: 1025306993

View in Genome Browser
Species Human (GRCh38)
Location 7:57869190-57869212
Sequence CTGCAAAAAGCAGCGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025306986_1025306993 9 Left 1025306986 7:57869158-57869180 CCACAAAAATCTGCGGCGGCGGG No data
Right 1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025306993 Original CRISPR CTGCAAAAAGCAGCGGTGGC GGG Intergenic
No off target data available for this crispr