ID: 1025320136

View in Genome Browser
Species Human (GRCh38)
Location 7:58087036-58087058
Sequence GGGCAAAAAGCTGTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025320136_1025320152 30 Left 1025320136 7:58087036-58087058 CCTGCCACCACAGCTTTTTGCCC No data
Right 1025320152 7:58087089-58087111 GCTTCCTGTCCCCGCCTCCGCGG No data
1025320136_1025320146 8 Left 1025320136 7:58087036-58087058 CCTGCCACCACAGCTTTTTGCCC No data
Right 1025320146 7:58087067-58087089 GCGGCTCCTTGCCCCCTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025320136 Original CRISPR GGGCAAAAAGCTGTGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr