ID: 1025483005

View in Genome Browser
Species Human (GRCh38)
Location 7:61009269-61009291
Sequence CCATATAAGCTACACGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025483002_1025483005 -3 Left 1025483002 7:61009249-61009271 CCTGGGGGAGAGATGCTATACCA No data
Right 1025483005 7:61009269-61009291 CCATATAAGCTACACGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025483005 Original CRISPR CCATATAAGCTACACGTGGT AGG Intergenic
No off target data available for this crispr