ID: 1025509760

View in Genome Browser
Species Human (GRCh38)
Location 7:61494640-61494662
Sequence AGCGTTTTGAAGGCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025509755_1025509760 20 Left 1025509755 7:61494597-61494619 CCTGGAAACAATCTTCTTGTAGA No data
Right 1025509760 7:61494640-61494662 AGCGTTTTGAAGGCTGTGGTTGG No data
1025509754_1025509760 23 Left 1025509754 7:61494594-61494616 CCGCCTGGAAACAATCTTCTTGT No data
Right 1025509760 7:61494640-61494662 AGCGTTTTGAAGGCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025509760 Original CRISPR AGCGTTTTGAAGGCTGTGGT TGG Intergenic
No off target data available for this crispr