ID: 1025569268

View in Genome Browser
Species Human (GRCh38)
Location 7:62537175-62537197
Sequence GATTCCTTTGAGGCCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025569265_1025569268 6 Left 1025569265 7:62537146-62537168 CCTTTGTGGAATCTTAAAGTGGA No data
Right 1025569268 7:62537175-62537197 GATTCCTTTGAGGCCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025569268 Original CRISPR GATTCCTTTGAGGCCTGTGG TGG Intergenic
No off target data available for this crispr