ID: 1025580962

View in Genome Browser
Species Human (GRCh38)
Location 7:62716696-62716718
Sequence AGAATCTACGTAGGGATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025580958_1025580962 17 Left 1025580958 7:62716656-62716678 CCTTTCTTTTCATTCAGCAGTTT No data
Right 1025580962 7:62716696-62716718 AGAATCTACGTAGGGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025580962 Original CRISPR AGAATCTACGTAGGGATATA TGG Intergenic
No off target data available for this crispr