ID: 1025582342

View in Genome Browser
Species Human (GRCh38)
Location 7:62736339-62736361
Sequence TCTGAAGCCCAGGAAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025582340_1025582342 -7 Left 1025582340 7:62736323-62736345 CCTACTATTCTCATGCTCTGAAG No data
Right 1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025582342 Original CRISPR TCTGAAGCCCAGGAAGAACA AGG Intergenic
No off target data available for this crispr