ID: 1025588549

View in Genome Browser
Species Human (GRCh38)
Location 7:62825053-62825075
Sequence CTGAGAAACCACTTTGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025588547_1025588549 5 Left 1025588547 7:62825025-62825047 CCCAGGATAAAAACTGGAAGGAA No data
Right 1025588549 7:62825053-62825075 CTGAGAAACCACTTTGTGATAGG No data
1025588548_1025588549 4 Left 1025588548 7:62825026-62825048 CCAGGATAAAAACTGGAAGGAAG No data
Right 1025588549 7:62825053-62825075 CTGAGAAACCACTTTGTGATAGG No data
1025588543_1025588549 27 Left 1025588543 7:62825003-62825025 CCAATGGTGAGAAAGTGAATATC No data
Right 1025588549 7:62825053-62825075 CTGAGAAACCACTTTGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025588549 Original CRISPR CTGAGAAACCACTTTGTGAT AGG Intergenic