ID: 1025599644

View in Genome Browser
Species Human (GRCh38)
Location 7:62979633-62979655
Sequence CAGGATAAAAACAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025599639_1025599644 1 Left 1025599639 7:62979609-62979631 CCAATGGCAAATAAGTGAATATC No data
Right 1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025599644 Original CRISPR CAGGATAAAAACAAGAAGGA AGG Intergenic
No off target data available for this crispr