ID: 1025603822

View in Genome Browser
Species Human (GRCh38)
Location 7:63024522-63024544
Sequence GGTTATAGTGGAGGAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025603822_1025603826 -9 Left 1025603822 7:63024522-63024544 CCAGCTTTTCCTCCACTATAACC No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025603822 Original CRISPR GGTTATAGTGGAGGAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr