ID: 1025603826

View in Genome Browser
Species Human (GRCh38)
Location 7:63024536-63024558
Sequence ACTATAACCTTCGGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025603820_1025603826 2 Left 1025603820 7:63024511-63024533 CCTAAAGTCTCCCAGCTTTTCCT No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data
1025603821_1025603826 -8 Left 1025603821 7:63024521-63024543 CCCAGCTTTTCCTCCACTATAAC No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data
1025603818_1025603826 15 Left 1025603818 7:63024498-63024520 CCAGTCACCAAGTCCTAAAGTCT No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data
1025603817_1025603826 25 Left 1025603817 7:63024488-63024510 CCAAGTAACACCAGTCACCAAGT No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data
1025603822_1025603826 -9 Left 1025603822 7:63024522-63024544 CCAGCTTTTCCTCCACTATAACC No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data
1025603819_1025603826 8 Left 1025603819 7:63024505-63024527 CCAAGTCCTAAAGTCTCCCAGCT No data
Right 1025603826 7:63024536-63024558 ACTATAACCTTCGGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025603826 Original CRISPR ACTATAACCTTCGGCCTCCC AGG Intergenic
No off target data available for this crispr