ID: 1025604626

View in Genome Browser
Species Human (GRCh38)
Location 7:63030424-63030446
Sequence CGGGCGGGGGGCGGTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025604605_1025604626 25 Left 1025604605 7:63030376-63030398 CCCAGACAGGCAGAGTCAGCTGA No data
Right 1025604626 7:63030424-63030446 CGGGCGGGGGGCGGTGTGGTCGG No data
1025604606_1025604626 24 Left 1025604606 7:63030377-63030399 CCAGACAGGCAGAGTCAGCTGAG No data
Right 1025604626 7:63030424-63030446 CGGGCGGGGGGCGGTGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025604626 Original CRISPR CGGGCGGGGGGCGGTGTGGT CGG Intergenic
No off target data available for this crispr