ID: 1025605751

View in Genome Browser
Species Human (GRCh38)
Location 7:63038852-63038874
Sequence GTCTCTCTGGACCTGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025605751_1025605758 6 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605758 7:63038881-63038903 TGGAAGGAGTGCCATGCGCTGGG No data
1025605751_1025605763 23 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605763 7:63038898-63038920 GCTGGGAAACAGGGTGGACATGG No data
1025605751_1025605760 14 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605760 7:63038889-63038911 GTGCCATGCGCTGGGAAACAGGG No data
1025605751_1025605759 13 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605759 7:63038888-63038910 AGTGCCATGCGCTGGGAAACAGG No data
1025605751_1025605762 17 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605762 7:63038892-63038914 CCATGCGCTGGGAAACAGGGTGG No data
1025605751_1025605756 -10 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605756 7:63038865-63038887 CCAGAGAGACAAAGGCTGGAAGG No data
1025605751_1025605757 5 Left 1025605751 7:63038852-63038874 CCACACTCCAGGTCCAGAGAGAC No data
Right 1025605757 7:63038880-63038902 CTGGAAGGAGTGCCATGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025605751 Original CRISPR GTCTCTCTGGACCTGGAGTG TGG (reversed) Intergenic
No off target data available for this crispr