ID: 1025608185

View in Genome Browser
Species Human (GRCh38)
Location 7:63054355-63054377
Sequence CCTCTTCGTGGGGCTTTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025608185_1025608192 9 Left 1025608185 7:63054355-63054377 CCTCGCAAAGCCCCACGAAGAGG 0: 1
1: 1
2: 0
3: 6
4: 82
Right 1025608192 7:63054387-63054409 TTCAGCATCTTTGTCCGCCGCGG 0: 1
1: 0
2: 1
3: 5
4: 54
1025608185_1025608193 21 Left 1025608185 7:63054355-63054377 CCTCGCAAAGCCCCACGAAGAGG 0: 1
1: 1
2: 0
3: 6
4: 82
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025608185 Original CRISPR CCTCTTCGTGGGGCTTTGCG AGG (reversed) Intergenic