ID: 1025608190

View in Genome Browser
Species Human (GRCh38)
Location 7:63054367-63054389
Sequence GAAGGCCAAGATCCTCTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025608190_1025608198 25 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1025608190_1025608193 9 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608190_1025608192 -3 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608192 7:63054387-63054409 TTCAGCATCTTTGTCCGCCGCGG 0: 1
1: 0
2: 1
3: 5
4: 54
1025608190_1025608196 19 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608196 7:63054409-63054431 GCGCAGCCGCCGGAGCCCACCGG 0: 1
1: 0
2: 2
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025608190 Original CRISPR GAAGGCCAAGATCCTCTTCG TGG (reversed) Intergenic