ID: 1025608191

View in Genome Browser
Species Human (GRCh38)
Location 7:63054385-63054407
Sequence GCGGCGGACAAAGATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025608191_1025608205 20 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608205 7:63054428-63054450 CCGGAGCCGGCGCGTTAGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 42
1025608191_1025608196 1 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608196 7:63054409-63054431 GCGCAGCCGCCGGAGCCCACCGG 0: 1
1: 0
2: 2
3: 13
4: 134
1025608191_1025608201 16 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608201 7:63054424-63054446 CCCACCGGAGCCGGCGCGTTAGG 0: 1
1: 0
2: 0
3: 2
4: 37
1025608191_1025608193 -9 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608191_1025608198 7 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1025608191_1025608203 17 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608203 7:63054425-63054447 CCACCGGAGCCGGCGCGTTAGGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025608191 Original CRISPR GCGGCGGACAAAGATGCTGA AGG (reversed) Intergenic