ID: 1025608193

View in Genome Browser
Species Human (GRCh38)
Location 7:63054399-63054421
Sequence GTCCGCCGCGGCGCAGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025608185_1025608193 21 Left 1025608185 7:63054355-63054377 CCTCGCAAAGCCCCACGAAGAGG 0: 1
1: 1
2: 0
3: 6
4: 82
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608190_1025608193 9 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608191_1025608193 -9 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608188_1025608193 11 Left 1025608188 7:63054365-63054387 CCCCACGAAGAGGATCTTGGCCT 0: 1
1: 1
2: 0
3: 7
4: 80
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608184_1025608193 26 Left 1025608184 7:63054350-63054372 CCTCACCTCGCAAAGCCCCACGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608189_1025608193 10 Left 1025608189 7:63054366-63054388 CCCACGAAGAGGATCTTGGCCTT 0: 1
1: 1
2: 0
3: 8
4: 82
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025608193 Original CRISPR GTCCGCCGCGGCGCAGCCGC CGG Intergenic