ID: 1025608193

View in Genome Browser
Species Human (GRCh38)
Location 7:63054399-63054421
Sequence GTCCGCCGCGGCGCAGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025608185_1025608193 21 Left 1025608185 7:63054355-63054377 CCTCGCAAAGCCCCACGAAGAGG 0: 1
1: 1
2: 0
3: 6
4: 82
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608189_1025608193 10 Left 1025608189 7:63054366-63054388 CCCACGAAGAGGATCTTGGCCTT 0: 1
1: 1
2: 0
3: 8
4: 82
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608184_1025608193 26 Left 1025608184 7:63054350-63054372 CCTCACCTCGCAAAGCCCCACGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608191_1025608193 -9 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608190_1025608193 9 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146
1025608188_1025608193 11 Left 1025608188 7:63054365-63054387 CCCCACGAAGAGGATCTTGGCCT 0: 1
1: 1
2: 0
3: 7
4: 80
Right 1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025608193 Original CRISPR GTCCGCCGCGGCGCAGCCGC CGG Intergenic
900185680 1:1332116-1332138 GGCCGCCGCGGAGCTGCTGCAGG + Exonic
900393542 1:2443985-2444007 GTTGGCAGCGGCGCAGCGGCAGG - Intronic
900581644 1:3412585-3412607 ATCCGGCGAGGAGCAGCCGCTGG + Exonic
901730141 1:11273258-11273280 GGCGGCCGCGGCTCAGCCGTGGG + Exonic
904775067 1:32901377-32901399 GTCCGGCGCCGCCCAGCCCCGGG - Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
905803869 1:40862192-40862214 TCCCGCCGCAGAGCAGCCGCTGG - Exonic
914004211 1:143718213-143718235 TTCTGCCGCGGTGGAGCCGCGGG + Intergenic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
919486864 1:198157119-198157141 GTCCGCCGGGGCGGCGCGGCGGG + Exonic
921185356 1:212665458-212665480 GTCCTCCGCGGGGCAGCCTCGGG - Intergenic
1063357243 10:5412727-5412749 GACCGCGGAGGCGAAGCCGCCGG + Exonic
1063418203 10:5890184-5890206 CTCCGCCCCGCCGCAGCCCCGGG - Intronic
1064694425 10:17950986-17951008 GTCCCCCACAGCGCAGCGGCGGG + Intergenic
1071309436 10:84328764-84328786 CTCGGCCGCGGCCCAGCTGCAGG - Exonic
1072059744 10:91798479-91798501 CGCCGCCGCGGGGCAGCCGGGGG + Exonic
1074503194 10:114044210-114044232 GGCCACCGCGGCGCGGCTGCTGG + Exonic
1077124362 11:925916-925938 CACCGCCGCGGAGGAGCCGCCGG - Exonic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1078057577 11:8019773-8019795 GGCCGGCGGGGCGCAGACGCCGG - Intronic
1078682195 11:13487335-13487357 GGCCGCCACAGTGCAGCCGCGGG + Intergenic
1080012493 11:27472558-27472580 GGCCGGCCCGGCGCAGCGGCGGG + Exonic
1088663870 11:112074654-112074676 TTCCGCCCCGGCTCAGCCTCCGG + Exonic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1092743057 12:11649038-11649060 GGCGGCCGCGCCGCAGACGCTGG - Intergenic
1101493925 12:105236014-105236036 GTGCGGCGCGGCTCAGCCGAGGG + Exonic
1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG + Exonic
1102248352 12:111369033-111369055 GGCCGGGCCGGCGCAGCCGCGGG + Exonic
1102475380 12:113185323-113185345 GTCCTCCGAGTCGCTGCCGCGGG + Exonic
1104891790 12:132143782-132143804 GGCCGCCTCGGCGCTGGCGCTGG + Exonic
1104928463 12:132325931-132325953 GTCGCCCGCGTCGCAGCGGCTGG - Intronic
1108688951 13:52845923-52845945 GTCCGCCGCGGGGCTGCCAAAGG + Exonic
1111197620 13:84894998-84895020 GTCCCCCACAGCGCAGCTGCGGG + Intergenic
1118601491 14:67473710-67473732 GGCAGCGGCCGCGCAGCCGCAGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121546978 14:94769857-94769879 GTCCGAGGAGGCGCCGCCGCTGG + Exonic
1123174249 14:106401772-106401794 GTCCGCCGCAGGGCAGAGGCCGG + Intergenic
1123182460 14:106482707-106482729 GTCCGCCGCAGGGCAGAGGCCGG + Intergenic
1202944441 14_KI270726v1_random:14022-14044 GTCCGCCGCAGGGCAGAGGCCGG - Intergenic
1123964083 15:25438500-25438522 GGCCGCCGCAGCCCAGGCGCGGG - Exonic
1125201140 15:37101511-37101533 GTCGCCCGAGGCGCAGCGGCGGG + Intergenic
1125834291 15:42736586-42736608 GCCCGCCGCGGGGTAGCCGCGGG - Exonic
1128067848 15:64775579-64775601 CGCCGCCGCGGCGCACTCGCCGG - Exonic
1131171935 15:90184973-90184995 GGCCGGCCCGGCGCAGCCCCTGG - Intronic
1131969242 15:97875656-97875678 GGCCCCCACAGCGCAGCCGCGGG - Intergenic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132490761 16:229315-229337 GTCCGCCCAGGCGCAGATGCGGG - Exonic
1132799921 16:1746956-1746978 GGCAGCCACGGCGGAGCCGCAGG + Intronic
1133006247 16:2883320-2883342 ACCCGCCGCGGCGCTGTCGCCGG + Exonic
1133011062 16:2912108-2912130 ATCCGCCGCGGCGCTGTCGCGGG + Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1139433130 16:66921817-66921839 AGCAGCCGCAGCGCAGCCGCCGG - Exonic
1140060458 16:71564986-71565008 ATCCGCGCCTGCGCAGCCGCGGG + Intronic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142711160 17:1724802-1724824 GTCCGCCTCTTCGCCGCCGCCGG + Intronic
1143106806 17:4534236-4534258 GTCCGCCCAGCCCCAGCCGCAGG - Intronic
1146322722 17:31859166-31859188 GGCCGCCGGGGCCCAGGCGCAGG - Exonic
1146356911 17:32142351-32142373 GGCCGCCGCAGCGCAGGCCCAGG - Exonic
1146912524 17:36657898-36657920 GGCCGCCGCCGAGCAGCCGCGGG - Intergenic
1147502701 17:40980862-40980884 GTCCAGCGCGGAGCAGCTGCAGG - Exonic
1148146880 17:45371696-45371718 GTCCCCCGCAGGGCAGCAGCCGG + Intergenic
1148238369 17:45983879-45983901 TTCCCCCGCGGAGCAGCAGCAGG - Exonic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1148556598 17:48582232-48582254 CTCCTCCGCGCCGCCGCCGCCGG - Intronic
1151591499 17:75047394-75047416 TGCCGCCGTCGCGCAGCCGCTGG + Exonic
1152822548 17:82444723-82444745 GTCCTCCGGGGCCCAGCCTCAGG - Intronic
1154132893 18:11751652-11751674 GGCGGCCGCGGCGCAGCGGAGGG + Intronic
1158190961 18:54828427-54828449 GTCCGCCGCGGCGGCGGGGCTGG - Exonic
1161706570 19:5824979-5825001 GGCCCCCGCGGCGCAGCAGGGGG + Intronic
1162046818 19:8005514-8005536 GCCCGCCCCGGAGCAGCCCCGGG - Exonic
1163442501 19:17328890-17328912 GCTCGCCGCGGCCCAGGCGCCGG + Exonic
1165454028 19:35900512-35900534 TTCCCCCGCGGAGCCGCCGCCGG + Exonic
1166539534 19:43596046-43596068 GTCCGCCGCGGCCCAGGGGCCGG - Exonic
1167418810 19:49390854-49390876 CCCTGCCGCGGCGCAGCTGCTGG - Exonic
1167662519 19:50804302-50804324 CTCCGCCGCGGGGCAGACGGAGG + Intronic
926151325 2:10427145-10427167 GCCGGCCGGGGCGCAGCCTCGGG - Exonic
926980229 2:18560464-18560486 CCCCGCCTCTGCGCAGCCGCTGG + Exonic
927533736 2:23836208-23836230 GCCCGCCCCGGTGCAGCAGCCGG - Intronic
928904505 2:36355871-36355893 CCCCGCAGCGGCGCAGCCTCCGG - Intergenic
929174133 2:38960048-38960070 GTCCTCTCCGGCGGAGCCGCTGG + Exonic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
929760531 2:44802651-44802673 GTACGCCGCGGCGCCGCAGCAGG - Intergenic
931021187 2:58046800-58046822 CTCCGCCTCGTCGCAGCGGCAGG + Intronic
934783195 2:96986121-96986143 GTCAGCCCCGGTGCGGCCGCCGG - Intronic
938422434 2:131155569-131155591 GTCCGCTGCGGCCCTGCGGCCGG + Intronic
944451770 2:199850993-199851015 GGCCGGGGCAGCGCAGCCGCCGG - Exonic
944632759 2:201643417-201643439 GGCTGCCCCGGCGCAACCGCCGG + Exonic
946248127 2:218398635-218398657 GTGCGCCGCGTCGCACCCGGCGG + Intronic
947717957 2:232351317-232351339 GGCCGCCGCGGTGCAGCCCTGGG + Intergenic
948209200 2:236179663-236179685 CTCCCACGCCGCGCAGCCGCGGG + Intergenic
1171034702 20:21705838-21705860 AGCCGCGGCGGCCCAGCCGCGGG - Exonic
1172702765 20:36863175-36863197 GGCCGCCGCGGCCCAGGCCCGGG - Exonic
1176120649 20:63453107-63453129 GTCCACCGCGGGGCGGCAGCTGG - Intronic
1176556250 21:8255723-8255745 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1176575189 21:8438765-8438787 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1179977032 21:44874027-44874049 GTTCCCCGCCGCGCAGGCGCAGG - Intergenic
1180559300 22:16602248-16602270 CTCCGGCCCGGCGCCGCCGCTGG - Intergenic
1182237132 22:28884232-28884254 GGCCTCCGGGGCGCATCCGCGGG + Intronic
1182261020 22:29073163-29073185 CTCCGCCGCGGCGCTCACGCTGG + Exonic
1183683773 22:39350211-39350233 GCCCGCCGCCGCGCCGCCGCCGG - Intronic
1184352773 22:43955480-43955502 GTCCGCGGTGGCGGAGCTGCAGG - Exonic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1185250243 22:49797822-49797844 GGCCGCCGCGGTGCCGCAGCAGG + Exonic
1185324205 22:50217718-50217740 GTCCCCCGCAGAGCAGCCTCAGG + Exonic
1203253238 22_KI270733v1_random:127820-127842 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203261293 22_KI270733v1_random:172901-172923 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
950018429 3:9769831-9769853 CCCCGCGGCGGGGCAGCCGCAGG - Exonic
957270947 3:78029856-78029878 GGCCGCCACAGCGCAGCGGCAGG - Intergenic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
973635906 4:52862094-52862116 GTCCGAGGCGGCGCAGCCCAGGG - Intergenic
975139048 4:70902127-70902149 GGCAGCCGCGGCGCACACGCTGG + Intergenic
980378102 4:131976334-131976356 GGCGGCTGCGGCGCAGCCCCAGG + Intergenic
982281050 4:153684165-153684187 GTGCGCCGCTGCGCAGCCGGAGG - Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
990955105 5:61332658-61332680 GCCGCCCGCGGCGCCGCCGCCGG - Exonic
991987807 5:72308132-72308154 GTCCACCGCGGCCCCGGCGCTGG + Intronic
992563241 5:77972897-77972919 GCCCGGCGCGGCGCGGCCCCCGG + Intergenic
992716304 5:79514221-79514243 GGCCGCCGCGGAGCCGCGGCCGG + Intergenic
997990806 5:138543135-138543157 CGCCGCCGCGGAGCCGCCGCCGG - Exonic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1007571054 6:42891073-42891095 GCCCGCAGCGGCGCGTCCGCAGG - Intergenic
1010032979 6:71289118-71289140 GTCCGGCGCGGGGCTGGCGCCGG - Exonic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1014009801 6:116462364-116462386 CTGCGCCGCGGAGCTGCCGCTGG + Exonic
1018613372 6:165663138-165663160 AGCCGCCGAGGCTCAGCCGCCGG - Intronic
1019404274 7:875650-875672 GTCCACCCAGGCACAGCCGCAGG + Intronic
1019520670 7:1459373-1459395 GGCGGTCGCGGCACAGCCGCGGG - Exonic
1019577904 7:1746369-1746391 GTCCGTCGCGGAGCCGCCGCTGG + Exonic
1022090754 7:27106656-27106678 GTGCCCCGCGGCCCAGCCGGGGG - Exonic
1022427949 7:30285539-30285561 GGCCGCCGCGGCGCCGCCGGAGG - Exonic
1022449886 7:30504799-30504821 GACCGCCGCGCGGCAGCCTCAGG + Exonic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1026765099 7:73155192-73155214 GTCCGCGGCGGCTCATCCGCGGG - Intergenic
1026850349 7:73719694-73719716 GGCTGGCGCTGCGCAGCCGCGGG - Intergenic
1027041572 7:74964947-74964969 GTCCGCGGCGGCTCATCCGCGGG - Exonic
1027082070 7:75237422-75237444 GTCCGCGGCGGCTCATCCGCGGG + Intergenic
1029390650 7:100271968-100271990 GTCCGCGGCAGCTCATCCGCTGG + Exonic
1034475122 7:151277141-151277163 GGCTGCAGCGGCGCAGGCGCCGG - Intronic
1034617945 7:152435571-152435593 CTCCGGCCCGGCGCCGCCGCTGG + Intronic
1035512966 8:206383-206405 GTGAGGCGCGGCGCAGGCGCAGG + Intergenic
1039843375 8:41309113-41309135 GGCCGCCGCGGGGCAGCCCTGGG - Exonic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1045098793 8:98825525-98825547 GGCCGCCATGGAGCAGCCGCCGG - Intronic
1049828345 8:144684914-144684936 GTGCGCTGCGGTGCAGCCTCGGG - Intergenic
1050160989 9:2718458-2718480 GCCCGCAGCGGCGCCGCCTCTGG + Exonic
1052362214 9:27573444-27573466 GCCCGCGGCGGCGGAGGCGCAGG - Intronic
1053763026 9:41358723-41358745 GGCGGCTGCGGCGCAGCCCCGGG - Intergenic
1054323974 9:63703994-63704016 GGCGGCTGCGGCGCAGCCCCAGG + Intergenic
1054541632 9:66269837-66269859 GGCGGCTGCGGCGCAGCCCCGGG - Intergenic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG + Intronic
1060555277 9:124504736-124504758 CTCGGCCGCGCCGCCGCCGCCGG + Intronic
1061208511 9:129177630-129177652 CGCCGCCGCCGCGCAGCCCCTGG + Exonic
1062160192 9:135075661-135075683 GTCCGCGTCCACGCAGCCGCCGG + Intronic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062464166 9:136673869-136673891 GTCCGCCGCAGTGAGGCCGCTGG + Exonic
1203469640 Un_GL000220v1:110967-110989 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1203477461 Un_GL000220v1:154939-154961 GGCGGCGGCGGCGCCGCCGCGGG - Intergenic
1187900940 X:24025859-24025881 TTCCCCCGCGGCGCCGCCGTCGG + Intronic