ID: 1025608198

View in Genome Browser
Species Human (GRCh38)
Location 7:63054415-63054437
Sequence CCGCCGGAGCCCACCGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025608190_1025608198 25 Left 1025608190 7:63054367-63054389 CCACGAAGAGGATCTTGGCCTTC 0: 1
1: 1
2: 0
3: 5
4: 103
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1025608194_1025608198 -9 Left 1025608194 7:63054401-63054423 CCGCCGCGGCGCAGCCGCCGGAG 0: 1
1: 0
2: 2
3: 20
4: 204
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1025608189_1025608198 26 Left 1025608189 7:63054366-63054388 CCCACGAAGAGGATCTTGGCCTT 0: 1
1: 1
2: 0
3: 8
4: 82
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1025608188_1025608198 27 Left 1025608188 7:63054365-63054387 CCCCACGAAGAGGATCTTGGCCT 0: 1
1: 1
2: 0
3: 7
4: 80
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118
1025608191_1025608198 7 Left 1025608191 7:63054385-63054407 CCTTCAGCATCTTTGTCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1025608198 7:63054415-63054437 CCGCCGGAGCCCACCGGAGCCGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025608198 Original CRISPR CCGCCGGAGCCCACCGGAGC CGG Intergenic