ID: 1025611171

View in Genome Browser
Species Human (GRCh38)
Location 7:63076866-63076888
Sequence GGGGAAGCCACATGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025611171_1025611181 27 Left 1025611171 7:63076866-63076888 CCTGGCTTCCATGTGGCTTCCCC No data
Right 1025611181 7:63076916-63076938 CTAGAAACAGAACTTGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025611171 Original CRISPR GGGGAAGCCACATGGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr