ID: 1025615230

View in Genome Browser
Species Human (GRCh38)
Location 7:63112546-63112568
Sequence CCAGGGGCACAGAAACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025615230_1025615239 3 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615239 7:63112572-63112594 TGGTGGCATTGGGACCCTCCAGG No data
1025615230_1025615245 18 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615245 7:63112587-63112609 CCTCCAGGCTGGGCTGAGCAGGG No data
1025615230_1025615241 8 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615241 7:63112577-63112599 GCATTGGGACCCTCCAGGCTGGG No data
1025615230_1025615234 -8 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615234 7:63112561-63112583 GCCCCTGGCTCTGGTGGCATTGG No data
1025615230_1025615236 -7 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615236 7:63112562-63112584 CCCCTGGCTCTGGTGGCATTGGG No data
1025615230_1025615243 17 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615243 7:63112586-63112608 CCCTCCAGGCTGGGCTGAGCAGG No data
1025615230_1025615240 7 Left 1025615230 7:63112546-63112568 CCATGATGTTTCTGTGCCCCTGG No data
Right 1025615240 7:63112576-63112598 GGCATTGGGACCCTCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025615230 Original CRISPR CCAGGGGCACAGAAACATCA TGG (reversed) Intergenic
No off target data available for this crispr