ID: 1025617688

View in Genome Browser
Species Human (GRCh38)
Location 7:63137123-63137145
Sequence CTTGTGAGTAATGGTAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025617688_1025617690 -10 Left 1025617688 7:63137123-63137145 CCTACACTACCATTACTCACAAG No data
Right 1025617690 7:63137136-63137158 TACTCACAAGAGCCAAGATATGG No data
1025617688_1025617692 15 Left 1025617688 7:63137123-63137145 CCTACACTACCATTACTCACAAG No data
Right 1025617692 7:63137161-63137183 GCAATCTAAGTGTCCATGAATGG 0: 2
1: 10
2: 120
3: 767
4: 2034

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025617688 Original CRISPR CTTGTGAGTAATGGTAGTGT AGG (reversed) Intergenic
No off target data available for this crispr