ID: 1025626454

View in Genome Browser
Species Human (GRCh38)
Location 7:63226717-63226739
Sequence CAGAATGAACAAAGGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025626454_1025626459 1 Left 1025626454 7:63226717-63226739 CCAAGCTGCCTTTGTTCATTCTG No data
Right 1025626459 7:63226741-63226763 GCATAGACCAACCTAACCATGGG No data
1025626454_1025626458 0 Left 1025626454 7:63226717-63226739 CCAAGCTGCCTTTGTTCATTCTG No data
Right 1025626458 7:63226740-63226762 GGCATAGACCAACCTAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025626454 Original CRISPR CAGAATGAACAAAGGCAGCT TGG (reversed) Intergenic
No off target data available for this crispr