ID: 1025626458

View in Genome Browser
Species Human (GRCh38)
Location 7:63226740-63226762
Sequence GGCATAGACCAACCTAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025626451_1025626458 25 Left 1025626451 7:63226692-63226714 CCTGATTCCATTTTGCTTCTAAC No data
Right 1025626458 7:63226740-63226762 GGCATAGACCAACCTAACCATGG No data
1025626452_1025626458 18 Left 1025626452 7:63226699-63226721 CCATTTTGCTTCTAACCTCCAAG 0: 23
1: 368
2: 517
3: 561
4: 790
Right 1025626458 7:63226740-63226762 GGCATAGACCAACCTAACCATGG No data
1025626453_1025626458 3 Left 1025626453 7:63226714-63226736 CCTCCAAGCTGCCTTTGTTCATT No data
Right 1025626458 7:63226740-63226762 GGCATAGACCAACCTAACCATGG No data
1025626457_1025626458 -8 Left 1025626457 7:63226725-63226747 CCTTTGTTCATTCTGGGCATAGA No data
Right 1025626458 7:63226740-63226762 GGCATAGACCAACCTAACCATGG No data
1025626454_1025626458 0 Left 1025626454 7:63226717-63226739 CCAAGCTGCCTTTGTTCATTCTG No data
Right 1025626458 7:63226740-63226762 GGCATAGACCAACCTAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025626458 Original CRISPR GGCATAGACCAACCTAACCA TGG Intergenic
No off target data available for this crispr