ID: 1025629457

View in Genome Browser
Species Human (GRCh38)
Location 7:63256276-63256298
Sequence ACTCAGTCTGACAAGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025629457_1025629458 -5 Left 1025629457 7:63256276-63256298 CCTTTAATCTTGTCAGACTGAGT No data
Right 1025629458 7:63256294-63256316 TGAGTACTTCTACCTACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025629457 Original CRISPR ACTCAGTCTGACAAGATTAA AGG (reversed) Intergenic
No off target data available for this crispr