ID: 1025639103

View in Genome Browser
Species Human (GRCh38)
Location 7:63350547-63350569
Sequence ACTCCCTCACCACTGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025639103_1025639108 30 Left 1025639103 7:63350547-63350569 CCTGGTGGCAGTGGTGAGGGAGT No data
Right 1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG No data
1025639103_1025639107 29 Left 1025639103 7:63350547-63350569 CCTGGTGGCAGTGGTGAGGGAGT No data
Right 1025639107 7:63350599-63350621 TCAGACTTAGCACTGTGAACTGG No data
1025639103_1025639105 1 Left 1025639103 7:63350547-63350569 CCTGGTGGCAGTGGTGAGGGAGT No data
Right 1025639105 7:63350571-63350593 AGGAGATCTCTAATGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025639103 Original CRISPR ACTCCCTCACCACTGCCACC AGG (reversed) Intergenic
No off target data available for this crispr