ID: 1025639108

View in Genome Browser
Species Human (GRCh38)
Location 7:63350600-63350622
Sequence CAGACTTAGCACTGTGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025639103_1025639108 30 Left 1025639103 7:63350547-63350569 CCTGGTGGCAGTGGTGAGGGAGT No data
Right 1025639108 7:63350600-63350622 CAGACTTAGCACTGTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025639108 Original CRISPR CAGACTTAGCACTGTGAACT GGG Intergenic
No off target data available for this crispr