ID: 1025641050

View in Genome Browser
Species Human (GRCh38)
Location 7:63369654-63369676
Sequence GGCACCATGCCAGCCAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025641047_1025641050 3 Left 1025641047 7:63369628-63369650 CCCAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data
1025641046_1025641050 4 Left 1025641046 7:63369627-63369649 CCCCAAGTGCTGGGATTACAGGC 0: 1272
1: 223636
2: 274075
3: 192409
4: 233718
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data
1025641040_1025641050 17 Left 1025641040 7:63369614-63369636 CCTGCCTCGGCCTCCCCAAGTGC 0: 397
1: 87411
2: 224747
3: 236235
4: 170994
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data
1025641039_1025641050 20 Left 1025641039 7:63369611-63369633 CCTCCTGCCTCGGCCTCCCCAAG 0: 162
1: 28411
2: 118684
3: 163789
4: 166661
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data
1025641044_1025641050 7 Left 1025641044 7:63369624-63369646 CCTCCCCAAGTGCTGGGATTACA 0: 1634
1: 296746
2: 268315
3: 159955
4: 198607
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data
1025641042_1025641050 13 Left 1025641042 7:63369618-63369640 CCTCGGCCTCCCCAAGTGCTGGG 0: 547
1: 118384
2: 265237
3: 216062
4: 143815
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data
1025641048_1025641050 2 Left 1025641048 7:63369629-63369651 CCAAGTGCTGGGATTACAGGCAA 0: 11
1: 1053
2: 2957
3: 4290
4: 7156
Right 1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025641050 Original CRISPR GGCACCATGCCAGCCAGAGT TGG Intergenic
No off target data available for this crispr