ID: 1025641404

View in Genome Browser
Species Human (GRCh38)
Location 7:63375195-63375217
Sequence GTTCTTGGCTTCAAGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025641404_1025641407 30 Left 1025641404 7:63375195-63375217 CCTTCTGACTTGAAGCCAAGAAC No data
Right 1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG No data
1025641404_1025641406 29 Left 1025641404 7:63375195-63375217 CCTTCTGACTTGAAGCCAAGAAC No data
Right 1025641406 7:63375247-63375269 AGTAAACATTCTTTCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025641404 Original CRISPR GTTCTTGGCTTCAAGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr