ID: 1025641407

View in Genome Browser
Species Human (GRCh38)
Location 7:63375248-63375270
Sequence GTAAACATTCTTTCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025641404_1025641407 30 Left 1025641404 7:63375195-63375217 CCTTCTGACTTGAAGCCAAGAAC No data
Right 1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG No data
1025641405_1025641407 15 Left 1025641405 7:63375210-63375232 CCAAGAACACTAGCAGAATGTCT No data
Right 1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025641407 Original CRISPR GTAAACATTCTTTCATCTCA GGG Intergenic
No off target data available for this crispr