ID: 1025643591

View in Genome Browser
Species Human (GRCh38)
Location 7:63397492-63397514
Sequence CAGACTTAGCACTGTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025643591_1025643596 30 Left 1025643591 7:63397492-63397514 CCCAGTTCACAGTGCTAAGTCTG No data
Right 1025643596 7:63397545-63397567 ACTCCCTCACCACTGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025643591 Original CRISPR CAGACTTAGCACTGTGAACT GGG (reversed) Intergenic
No off target data available for this crispr