ID: 1025656200

View in Genome Browser
Species Human (GRCh38)
Location 7:63521614-63521636
Sequence CCTCCGTGTCCCAAAGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025656194_1025656200 0 Left 1025656194 7:63521591-63521613 CCTGACCTCAAGTGATCCTCCTG 0: 1016
1: 15561
2: 65911
3: 130893
4: 219557
Right 1025656200 7:63521614-63521636 CCTCCGTGTCCCAAAGTTCTGGG No data
1025656195_1025656200 -5 Left 1025656195 7:63521596-63521618 CCTCAAGTGATCCTCCTGCCTCC 0: 51
1: 2467
2: 15621
3: 53107
4: 96291
Right 1025656200 7:63521614-63521636 CCTCCGTGTCCCAAAGTTCTGGG No data
1025656192_1025656200 27 Left 1025656192 7:63521564-63521586 CCATGTTGGCCAGGCTGGTCTTG 0: 36878
1: 108443
2: 168596
3: 179002
4: 104175
Right 1025656200 7:63521614-63521636 CCTCCGTGTCCCAAAGTTCTGGG No data
1025656193_1025656200 18 Left 1025656193 7:63521573-63521595 CCAGGCTGGTCTTGAACTCCTGA 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
Right 1025656200 7:63521614-63521636 CCTCCGTGTCCCAAAGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025656200 Original CRISPR CCTCCGTGTCCCAAAGTTCT GGG Intergenic
No off target data available for this crispr