ID: 1025658888

View in Genome Browser
Species Human (GRCh38)
Location 7:63544614-63544636
Sequence CTTTGGATATGGAGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025658888_1025658896 16 Left 1025658888 7:63544614-63544636 CCAATTTCCCTCCATATCCAAAG No data
Right 1025658896 7:63544653-63544675 TTCACGTGTGCAGCACTCCCTGG No data
1025658888_1025658897 24 Left 1025658888 7:63544614-63544636 CCAATTTCCCTCCATATCCAAAG No data
Right 1025658897 7:63544661-63544683 TGCAGCACTCCCTGGTTTCCTGG No data
1025658888_1025658899 26 Left 1025658888 7:63544614-63544636 CCAATTTCCCTCCATATCCAAAG No data
Right 1025658899 7:63544663-63544685 CAGCACTCCCTGGTTTCCTGGGG No data
1025658888_1025658898 25 Left 1025658888 7:63544614-63544636 CCAATTTCCCTCCATATCCAAAG No data
Right 1025658898 7:63544662-63544684 GCAGCACTCCCTGGTTTCCTGGG No data
1025658888_1025658900 27 Left 1025658888 7:63544614-63544636 CCAATTTCCCTCCATATCCAAAG No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025658888 Original CRISPR CTTTGGATATGGAGGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr