ID: 1025658892

View in Genome Browser
Species Human (GRCh38)
Location 7:63544622-63544644
Sequence AACCCACACTTTGGATATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025658892_1025658896 8 Left 1025658892 7:63544622-63544644 CCTCCATATCCAAAGTGTGGGTT No data
Right 1025658896 7:63544653-63544675 TTCACGTGTGCAGCACTCCCTGG No data
1025658892_1025658900 19 Left 1025658892 7:63544622-63544644 CCTCCATATCCAAAGTGTGGGTT No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data
1025658892_1025658898 17 Left 1025658892 7:63544622-63544644 CCTCCATATCCAAAGTGTGGGTT No data
Right 1025658898 7:63544662-63544684 GCAGCACTCCCTGGTTTCCTGGG No data
1025658892_1025658897 16 Left 1025658892 7:63544622-63544644 CCTCCATATCCAAAGTGTGGGTT No data
Right 1025658897 7:63544661-63544683 TGCAGCACTCCCTGGTTTCCTGG No data
1025658892_1025658899 18 Left 1025658892 7:63544622-63544644 CCTCCATATCCAAAGTGTGGGTT No data
Right 1025658899 7:63544663-63544685 CAGCACTCCCTGGTTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025658892 Original CRISPR AACCCACACTTTGGATATGG AGG (reversed) Intergenic
No off target data available for this crispr