ID: 1025658900

View in Genome Browser
Species Human (GRCh38)
Location 7:63544664-63544686
Sequence AGCACTCCCTGGTTTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025658893_1025658900 16 Left 1025658893 7:63544625-63544647 CCATATCCAAAGTGTGGGTTGTG No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data
1025658891_1025658900 20 Left 1025658891 7:63544621-63544643 CCCTCCATATCCAAAGTGTGGGT No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data
1025658888_1025658900 27 Left 1025658888 7:63544614-63544636 CCAATTTCCCTCCATATCCAAAG No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data
1025658892_1025658900 19 Left 1025658892 7:63544622-63544644 CCTCCATATCCAAAGTGTGGGTT No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data
1025658895_1025658900 10 Left 1025658895 7:63544631-63544653 CCAAAGTGTGGGTTGTGGAGAAT No data
Right 1025658900 7:63544664-63544686 AGCACTCCCTGGTTTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025658900 Original CRISPR AGCACTCCCTGGTTTCCTGG GGG Intergenic
No off target data available for this crispr