ID: 1025659734

View in Genome Browser
Species Human (GRCh38)
Location 7:63550558-63550580
Sequence GGTGAGCTGCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659734_1025659740 -9 Left 1025659734 7:63550558-63550580 CCATCCTCCCTCTGCAGCTCACC No data
Right 1025659740 7:63550572-63550594 CAGCTCACCCAGTCTGTGGTGGG 0: 3
1: 0
2: 2
3: 16
4: 203
1025659734_1025659739 -10 Left 1025659734 7:63550558-63550580 CCATCCTCCCTCTGCAGCTCACC No data
Right 1025659739 7:63550571-63550593 GCAGCTCACCCAGTCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659734 Original CRISPR GGTGAGCTGCAGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr