ID: 1025659838

View in Genome Browser
Species Human (GRCh38)
Location 7:63551048-63551070
Sequence CCTCCAAGGCATGCAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659838_1025659849 23 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659838_1025659843 -6 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659838_1025659848 22 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659838_1025659846 18 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218
1025659838_1025659847 19 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659838_1025659845 17 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659838 Original CRISPR CCTCCAAGGCATGCAGTGGA CGG (reversed) Intergenic
No off target data available for this crispr