ID: 1025659843

View in Genome Browser
Species Human (GRCh38)
Location 7:63551065-63551087
Sequence TGGAGGTGCAAGCCAAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659831_1025659843 15 Left 1025659831 7:63551027-63551049 CCTCCCTGCAGGGAGCCCAGCCC No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659835_1025659843 -1 Left 1025659835 7:63551043-63551065 CCAGCCCGTCCACTGCATGCCTT No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659830_1025659843 18 Left 1025659830 7:63551024-63551046 CCACCTCCCTGCAGGGAGCCCAG No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659834_1025659843 0 Left 1025659834 7:63551042-63551064 CCCAGCCCGTCCACTGCATGCCT No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659824_1025659843 28 Left 1025659824 7:63551014-63551036 CCGCACCCACCCACCTCCCTGCA No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659838_1025659843 -6 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659828_1025659843 22 Left 1025659828 7:63551020-63551042 CCACCCACCTCCCTGCAGGGAGC No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659823_1025659843 29 Left 1025659823 7:63551013-63551035 CCCGCACCCACCCACCTCCCTGC No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659833_1025659843 11 Left 1025659833 7:63551031-63551053 CCTGCAGGGAGCCCAGCCCGTCC No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659832_1025659843 12 Left 1025659832 7:63551030-63551052 CCCTGCAGGGAGCCCAGCCCGTC No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659840_1025659843 -10 Left 1025659840 7:63551052-63551074 CCACTGCATGCCTTGGAGGTGCA No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659827_1025659843 23 Left 1025659827 7:63551019-63551041 CCCACCCACCTCCCTGCAGGGAG No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659829_1025659843 19 Left 1025659829 7:63551023-63551045 CCCACCTCCCTGCAGGGAGCCCA No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data
1025659837_1025659843 -5 Left 1025659837 7:63551047-63551069 CCCGTCCACTGCATGCCTTGGAG No data
Right 1025659843 7:63551065-63551087 TGGAGGTGCAAGCCAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659843 Original CRISPR TGGAGGTGCAAGCCAAGGCT TGG Intergenic
No off target data available for this crispr