ID: 1025659845

View in Genome Browser
Species Human (GRCh38)
Location 7:63551088-63551110
Sequence TAACACAGCTCCCTCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 3, 1: 0, 2: 0, 3: 20, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659835_1025659845 22 Left 1025659835 7:63551043-63551065 CCAGCCCGTCCACTGCATGCCTT No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139
1025659840_1025659845 13 Left 1025659840 7:63551052-63551074 CCACTGCATGCCTTGGAGGTGCA No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139
1025659837_1025659845 18 Left 1025659837 7:63551047-63551069 CCCGTCCACTGCATGCCTTGGAG No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139
1025659834_1025659845 23 Left 1025659834 7:63551042-63551064 CCCAGCCCGTCCACTGCATGCCT No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139
1025659842_1025659845 3 Left 1025659842 7:63551062-63551084 CCTTGGAGGTGCAAGCCAAGGCT No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139
1025659838_1025659845 17 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG 0: 3
1: 0
2: 0
3: 20
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659845 Original CRISPR TAACACAGCTCCCTCTGAGA AGG Intergenic
907247183 1:53115744-53115766 CAACACAGCCCCCTGTGACAAGG - Intronic
907827359 1:58031645-58031667 CAATTCAGCTTCCTCTGAGAGGG - Intronic
909524604 1:76608545-76608567 GACAACAGCTCCTTCTGAGAGGG - Intronic
910146739 1:84088588-84088610 TAGCTCAGCTCCCTCTGAGTAGG + Intronic
910443264 1:87274806-87274828 AAACCCAACTCCCTCTGAAATGG + Intergenic
911070364 1:93827449-93827471 TGACCCAGCTCCCTCCGAGAGGG + Intronic
912324445 1:108744741-108744763 TAATACAGGTCCCTCTGGGTTGG - Intergenic
912720103 1:112012779-112012801 TAGCACAGTTCACTCTAAGAAGG + Intergenic
913429559 1:118776063-118776085 CAATTCAGCTCCCTCTGCGAGGG - Intergenic
915610408 1:156987536-156987558 TAACACAGTTGTCTCTGAGGAGG + Intronic
921257267 1:213353941-213353963 TAACAAAGGATCCTCTGAGATGG - Intergenic
921443383 1:215215393-215215415 TAACACAGCTCCCTGTTAAATGG + Intronic
924325592 1:242891320-242891342 GAAAACAGCTTCTTCTGAGACGG + Intergenic
1063344202 10:5295923-5295945 GAACACAGCTCCCTTTAATACGG + Intergenic
1064242019 10:13639471-13639493 TACTACAGTTCCGTCTGAGATGG + Intronic
1064655148 10:17549287-17549309 GAACACCTCTCCCTCTGAGCTGG + Intergenic
1066561559 10:36675150-36675172 GAAAACAGCTCTCTCTGAGGAGG - Intergenic
1067275783 10:44832992-44833014 TATGGCAGCTGCCTCTGAGATGG + Intergenic
1067748570 10:48955449-48955471 GAACTCAGCTCTTTCTGAGAGGG - Intronic
1068283287 10:54904815-54904837 TACCACAGCTCACTCTCAGAAGG + Intronic
1070439919 10:76433178-76433200 TAACACAGATACCTGTGAGAAGG - Intronic
1070788158 10:79174273-79174295 ACACACAGCTCCCACTGGGAGGG + Intronic
1075024236 10:118972208-118972230 TAACACAGCTGTCTCTGCAATGG + Intergenic
1076872270 10:133199913-133199935 TCACACTGGTCCCTCTGAGCAGG - Intronic
1079659106 11:23018136-23018158 TAACAGAGTTCCCTCTCAGTGGG - Intergenic
1080036529 11:27718426-27718448 TAAAACAGCACCATCTGGGAAGG + Intronic
1080883092 11:36340907-36340929 TACCACAGCTGGCTCTGAGATGG - Intronic
1083267103 11:61551773-61551795 AAACACAGTTCCCTCTGCCACGG + Intronic
1083968312 11:66056827-66056849 TAACACAGCTGCCTACGGGAGGG - Exonic
1084636409 11:70395957-70395979 TCACAGGGCTCCCTCTGAGATGG + Intergenic
1084953734 11:72680502-72680524 GAACACAGGTCCCTCTCAGATGG - Intergenic
1085517089 11:77118030-77118052 GAACACAGCTGGCTTTGAGAGGG - Intronic
1089226866 11:116931813-116931835 TAACTCAGCTCCCCCTAAGCAGG + Intronic
1091649229 12:2297235-2297257 TAACACAGCTCCTGCAGTGACGG - Intronic
1094350327 12:29517434-29517456 AAGCGGAGCTCCCTCTGAGAAGG + Exonic
1096009467 12:48200930-48200952 AAACACAGCTTTCTTTGAGAAGG - Intergenic
1096018711 12:48303860-48303882 TAGCACAGATCTCTCTGGGATGG + Intergenic
1097157455 12:57023254-57023276 TGGCGCAGCTCCCTCTGGGAGGG - Intronic
1097905253 12:64912846-64912868 TAAGACAGCTCCCTTTGGAAAGG - Intergenic
1099061504 12:77916059-77916081 TAAGACAGGCCACTCTGAGATGG + Intronic
1100954867 12:99895715-99895737 CAGCACACCTCCCTCTAAGAAGG + Intronic
1102952027 12:117037494-117037516 TAACACATCTGCCTTTGAGAAGG + Intergenic
1103855474 12:123966418-123966440 GAACACAGCTTCCTCTCACATGG - Intronic
1108474050 13:50796083-50796105 GAACATAGCTCCCTCAGATAAGG - Intronic
1109903535 13:68807217-68807239 TAACAAAGCTCCCTTTCAGATGG - Intergenic
1112919308 13:104591592-104591614 TAGCACCATTCCCTCTGAGAAGG + Intergenic
1114899810 14:27043586-27043608 TAACATATCTCCCTTTTAGAGGG - Intergenic
1119853300 14:77881490-77881512 TAATACTCCTCCCTTTGAGAGGG - Intronic
1120714261 14:87823255-87823277 TCACCCAGTCCCCTCTGAGAAGG - Intergenic
1121443516 14:93964091-93964113 TAACCCAGAGCCCACTGAGAGGG + Intronic
1128683225 15:69666331-69666353 TAGCACACATCCCTCTGGGAGGG + Intergenic
1129368732 15:75074005-75074027 CAACAGAGCTGCCTTTGAGAGGG + Intronic
1130968474 15:88714647-88714669 TCACCCAGGTCCCTCTTAGAGGG - Intergenic
1131529019 15:93176561-93176583 TAGCCCAGCGCCATCTGAGAAGG + Intergenic
1133143788 16:3768568-3768590 TACCACACCTGCCTCTGAGAAGG - Intronic
1133757634 16:8774552-8774574 GGACACAGCTCCCTCTGACGAGG + Intronic
1134534490 16:15014775-15014797 TAACTAAGCTCTCTCTGAAAAGG + Intronic
1135667333 16:24346872-24346894 TCACTCAGCTGCCTCTGAGTCGG + Intronic
1138528793 16:57623686-57623708 ACACACAGCTCCCTTTGTGAAGG + Intronic
1138538161 16:57670963-57670985 TAGGAGAGCTCCCTCTGCGATGG - Intronic
1138620921 16:58210686-58210708 TAAGAAAGGTCTCTCTGAGAAGG + Intergenic
1139861554 16:70026002-70026024 TAACTAAGCTCTCTCTGAAAAGG - Intergenic
1141413242 16:83850774-83850796 TTAGGCAGCTGCCTCTGAGATGG - Intergenic
1142865947 17:2791623-2791645 TAACAGGGCACCCTCTCAGAGGG + Intronic
1143518574 17:7432443-7432465 TAATACAGGTACCTCTGAGAAGG - Intergenic
1146403555 17:32519059-32519081 TGACACCGCTCCCTCTCAAACGG + Intronic
1147656732 17:42095412-42095434 AGGCGCAGCTCCCTCTGAGAAGG + Intergenic
1147905274 17:43818457-43818479 TTTCTCAGCTCCCTCAGAGATGG - Intronic
1149550182 17:57533953-57533975 TGACACAGCACCCACTGTGATGG + Intronic
1150491580 17:65577860-65577882 TCACACAGCTCCCTGAGAGGTGG + Intronic
1151033283 17:70767388-70767410 TAACACAGCTACCTCAGGAAAGG + Intergenic
1151972863 17:77467745-77467767 TAACACCGCTCCCTCTGTGCCGG - Intronic
1153521157 18:5955332-5955354 TAACACAGCTCCTTATTACAGGG + Exonic
1157224567 18:45850931-45850953 TGAGACAGATCCCTCTGAGACGG + Exonic
1158818449 18:61130750-61130772 GAAAACAGCTCCCCTTGAGAGGG + Intergenic
1163725938 19:18923038-18923060 TGTCACAACTTCCTCTGAGATGG - Intronic
1164551338 19:29214935-29214957 TATCACAATTCCCTCTGAGTTGG + Intergenic
1165079712 19:33300428-33300450 TAACTCCGGTCCCTCTGGGATGG + Exonic
1165099322 19:33429142-33429164 CAACTCTGCCCCCTCTGAGAAGG - Intronic
927275365 2:21257904-21257926 AAACACAACTGTCTCTGAGAAGG - Intergenic
928777891 2:34789009-34789031 TAACACAGCTCTCTCTTTCAGGG - Intergenic
931711854 2:64994596-64994618 CAGCACACCTCCCTCTGTGAAGG - Intronic
931906630 2:66849929-66849951 TAAAACAGCTACCCCTAAGAAGG - Intergenic
935762950 2:106338313-106338335 TCAAACAGCTGCCTCTGAGTGGG - Intergenic
936915084 2:117632044-117632066 TAAAACATCTCTGTCTGAGATGG - Intergenic
937219037 2:120330983-120331005 TAACACAGCTTCCGCGGAGCGGG + Intergenic
938012830 2:127842428-127842450 TCAGACAGCTTCCTTTGAGATGG - Intergenic
938187291 2:129242978-129243000 TCACAAAGCTCCCTCTGGGTAGG + Intergenic
944484211 2:200186957-200186979 TAACACAGCTTGCTCTAAGCAGG + Intergenic
945403879 2:209422673-209422695 TTTCACAGCTTCCTCTGTGATGG + Intergenic
947712903 2:232326050-232326072 TAGCACAGCTCCCCAGGAGAGGG + Intronic
1170129874 20:13007925-13007947 TAACTCAGCTCCCTTGGACAGGG - Intergenic
1171425581 20:25046665-25046687 GAACAAAGCCCCTTCTGAGAAGG - Intronic
1172385529 20:34531553-34531575 TTACACAGCTCCCGCTTATATGG + Intronic
1172642237 20:36447353-36447375 TAAAACACATCCCTTTGAGAAGG - Intronic
1173034517 20:39395821-39395843 AAAGGCAGCTTCCTCTGAGATGG + Intergenic
1173984593 20:47251256-47251278 TCACACAGCCACCTCTGAGAGGG + Intronic
1177609869 21:23432527-23432549 TGCCACAGCTCTCTCTGAGTTGG - Intergenic
1182547327 22:31083811-31083833 TGGCACAGCTCCTTCTTAGATGG - Intronic
949255530 3:2041134-2041156 TAACACAACACACTCTGATATGG - Intergenic
950177413 3:10884796-10884818 TAACAGGCCTCCCTCTCAGAGGG - Intronic
951867000 3:27319783-27319805 TAAGATAGCTCCCACTGGGATGG + Intronic
951867122 3:27320971-27320993 TAAGATAGCTCCCACTGGGATGG + Intronic
952026425 3:29088046-29088068 TCCCACAGCTCACTCTCAGAGGG - Intergenic
953686356 3:45081337-45081359 TGACACCTCTCCCACTGAGATGG + Intergenic
958968983 3:100590397-100590419 TAAGGCAGGTCCATCTGAGAAGG - Intergenic
961943257 3:130658563-130658585 TAACACTGCTCCTTCTAAGAAGG - Intronic
962973323 3:140424949-140424971 GCACACAGCTCCCTCTCAGCTGG - Intronic
963944655 3:151132206-151132228 GCCCAAAGCTCCCTCTGAGATGG - Intronic
965426209 3:168526940-168526962 TCAGACAGCTCCCACTGAAATGG - Intergenic
966687945 3:182716222-182716244 TAAGACAGCTCCCACACAGAAGG - Intergenic
967224126 3:187274941-187274963 AAGCCCAGCTCCCTCTGAGACGG - Intronic
971059074 4:22946940-22946962 TCACACATCTCCTTCTGAGACGG - Intergenic
972689310 4:41381450-41381472 CAATTCAGCTCCCTCTGTGAGGG - Intronic
982087800 4:151853956-151853978 TAACACAGCTCCCACTGGGCAGG - Intergenic
984562264 4:181284434-181284456 TAACCCAGCTTCCTCTCTGAAGG - Intergenic
986469429 5:8059495-8059517 TAACACAGCTCCTTCTGCTCAGG - Intergenic
989646557 5:43639738-43639760 TTACTCAGTTCCCTCTCAGAGGG - Intronic
994318007 5:98356970-98356992 TGAAACACCTACCTCTGAGAGGG + Intergenic
1001040057 5:168328125-168328147 TAACACATCTGCCTCTTGGATGG + Intronic
1001572216 5:172737181-172737203 TAACACACCTCCCTTCCAGAGGG - Intergenic
1002793676 6:453194-453216 TGACACAGCTGCCTCTGGCAAGG + Intergenic
1002823319 6:749595-749617 CAACACACCTCCCTAGGAGAGGG - Intergenic
1002938849 6:1698657-1698679 CAGCACAGCCCACTCTGAGAAGG + Intronic
1005456693 6:26026871-26026893 AATCACAGCTCTTTCTGAGAGGG + Exonic
1006993156 6:38232901-38232923 GAACACAGCATCCTCTGGGAAGG - Intronic
1007321881 6:41033601-41033623 AAAGACAGGTCCCTCTTAGATGG + Intronic
1008866571 6:56218458-56218480 GACAACAGCTCCCTCTTAGATGG + Intronic
1009820892 6:68799710-68799732 TAAAAAAGATCCCTGTGAGAAGG + Intronic
1013246872 6:108295120-108295142 TAGCACAGAGCCCGCTGAGAGGG + Exonic
1013246873 6:108295130-108295152 CAACACATCTCCCTCTCAGCGGG - Exonic
1016287723 6:142491623-142491645 TAACACAGCTACAACTGAAATGG + Intergenic
1016408750 6:143759887-143759909 GAACACAGATCCCTTTCAGATGG + Intronic
1018968463 6:168507860-168507882 AAAAATAGCTCACTCTGAGATGG + Intronic
1018982241 6:168610487-168610509 TAACACAGCAGCCTTTGAGTAGG + Intronic
1021412457 7:20343741-20343763 TAACAGAGCTACCTATGAGCAGG + Intronic
1021964937 7:25908019-25908041 TACCAGAGCTCCATCTGAGCAGG - Intergenic
1024295938 7:47842424-47842446 TGACACAAATCCCTCAGAGAGGG - Intronic
1025212109 7:57025740-57025762 TAACACAGCTCCCTCTGAGAAGG - Intergenic
1025659845 7:63551088-63551110 TAACACAGCTCCCTCTGAGAAGG + Intergenic
1029675287 7:102064495-102064517 TAACACAGCTCCCTCTGAGAAGG - Intronic
1029682290 7:102119866-102119888 AAACATAGCTCCTTCTCAGATGG + Intronic
1032280951 7:130500820-130500842 TCCCACAGCTCACTCTCAGAGGG - Exonic
1036031340 8:4977519-4977541 TCACAGAGCTCCCTTTGAGAGGG + Intronic
1037590081 8:20304574-20304596 AAACTCAGCTCCCTCAGAGCTGG - Intergenic
1039440176 8:37589579-37589601 GACAACAGCTGCCTCTGAGAAGG + Intergenic
1051823331 9:21192765-21192787 GAACAGAGCTCCCAGTGAGAAGG + Intergenic
1051827134 9:21233364-21233386 GAACAGAGCTCCCAGTGAGAAGG + Intronic
1052112490 9:24604421-24604443 AAACACAGTTCCCTTTGATATGG - Intergenic
1060698493 9:125730528-125730550 AGAAACAGCTGCCTCTGAGATGG + Intergenic
1061299364 9:129695957-129695979 TTATAAAGCCCCCTCTGAGAAGG + Intronic
1186380723 X:9055792-9055814 GTCCACAGCCCCCTCTGAGATGG - Intronic
1186781591 X:12917322-12917344 AAACCCAGCTCCTTTTGAGATGG - Intronic
1188696873 X:33204380-33204402 AAACATTGCTCCCTCTGACAGGG + Intronic
1191988947 X:67010979-67011001 GAACACAGCTGCCACTGTGAGGG + Intergenic
1192177190 X:68893435-68893457 TGTCCCAGCTCTCTCTGAGAGGG + Intergenic
1195148709 X:102043912-102043934 GGACACAGCTCCCACTGGGAGGG + Intergenic
1195560930 X:106282834-106282856 TAGCACTGGTCTCTCTGAGAGGG + Intergenic
1196651604 X:118173806-118173828 AAGCACAGCTTCCTCTGGGAAGG - Intergenic
1197572297 X:128163989-128164011 AATTACAGCTCCCTCTCAGATGG - Intergenic
1200738564 Y:6828287-6828309 GAAGACAGATGCCTCTGAGATGG - Intergenic
1201223100 Y:11790311-11790333 GAAAACAGCTTCTTCTGAGATGG + Intergenic