ID: 1025659846

View in Genome Browser
Species Human (GRCh38)
Location 7:63551089-63551111
Sequence AACACAGCTCCCTCTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 3, 1: 0, 2: 0, 3: 21, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659838_1025659846 18 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218
1025659842_1025659846 4 Left 1025659842 7:63551062-63551084 CCTTGGAGGTGCAAGCCAAGGCT No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218
1025659834_1025659846 24 Left 1025659834 7:63551042-63551064 CCCAGCCCGTCCACTGCATGCCT No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218
1025659835_1025659846 23 Left 1025659835 7:63551043-63551065 CCAGCCCGTCCACTGCATGCCTT No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218
1025659837_1025659846 19 Left 1025659837 7:63551047-63551069 CCCGTCCACTGCATGCCTTGGAG No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218
1025659840_1025659846 14 Left 1025659840 7:63551052-63551074 CCACTGCATGCCTTGGAGGTGCA No data
Right 1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG 0: 3
1: 0
2: 0
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659846 Original CRISPR AACACAGCTCCCTCTGAGAA GGG Intergenic
900463334 1:2811593-2811615 CACACAGCCCCCTCTGTGGATGG - Intergenic
900528305 1:3140011-3140033 GACGCATCTCCCTCGGAGAATGG + Intronic
900682790 1:3926030-3926052 AACACAGCGTTCTCTGTGAAGGG - Intergenic
900955296 1:5883009-5883031 AACAGGGCTCCCGGTGAGAAGGG + Intronic
902688883 1:18097183-18097205 AGCTCAGCTTCTTCTGAGAATGG - Intergenic
902882900 1:19384537-19384559 AGCACAGCTCCCTGTGTCAATGG - Intronic
904206015 1:28855669-28855691 ATCCCAGCCCCCTCTGGGAATGG + Intronic
905186559 1:36201183-36201205 AACACAGGTCCCTGTTATAAAGG + Intergenic
906087194 1:43146091-43146113 AATACAGATCTCACTGAGAAAGG + Intronic
909181787 1:72433560-72433582 ACCACAGGTCCCTCTGGGGAGGG - Intergenic
909926109 1:81439716-81439738 AACACACCACCGTCTGTGAATGG - Intronic
911289972 1:96045783-96045805 ACGACTTCTCCCTCTGAGAAAGG + Intergenic
912720104 1:112012780-112012802 AGCACAGTTCACTCTAAGAAGGG + Intergenic
913527457 1:119707667-119707689 AAAAAAGTTCCCTCTGAGTAGGG + Intronic
914682341 1:149947517-149947539 AACTCAGCTGCAGCTGAGAATGG + Intronic
914827273 1:151145365-151145387 GACCCTGCTCCCTCTGAGGAAGG - Intronic
915610409 1:156987537-156987559 AACACAGTTGTCTCTGAGGAGGG + Intronic
915836500 1:159180918-159180940 AAGACAGAGCCCACTGAGAAAGG + Intronic
915844658 1:159251425-159251447 AACTCAGCTCCTTCTTAGAGAGG - Intergenic
919806319 1:201382881-201382903 CACACAGCTCCCTGGGGGAAGGG - Intronic
921519316 1:216140232-216140254 AATACAGCTCCCACAAAGAAAGG + Intronic
923608407 1:235466779-235466801 AAAACAGTTCACTCTGAGTAAGG - Intronic
924325593 1:242891321-242891343 AAAACAGCTTCTTCTGAGACGGG + Intergenic
1063862602 10:10327907-10327929 ACTTCAGCTCCCTTTGAGAAAGG + Intergenic
1065815388 10:29478593-29478615 GACACAGCTCCTTATGAAAAAGG + Intronic
1067748569 10:48955448-48955470 AACTCAGCTCTTTCTGAGAGGGG - Intronic
1070788159 10:79174274-79174296 CACACAGCTCCCACTGGGAGGGG + Intronic
1072103847 10:92255134-92255156 GACTCAGCTTCCTCTGAGAAAGG - Intronic
1073075971 10:100826215-100826237 ACCCCAGCTCCCTCTCAGAGAGG + Intronic
1074079828 10:110158636-110158658 AAAACACCACCCTATGAGAAAGG - Intergenic
1074195578 10:111181678-111181700 AAAACAGTTCCCTCTGTGTACGG - Intergenic
1075786759 10:125055266-125055288 AACACAGCCGCTTCTGAGACAGG + Intronic
1076606840 10:131694860-131694882 CACACAGCTCCTTCTGGGGAAGG - Intergenic
1076872269 10:133199912-133199934 CACACTGGTCCCTCTGAGCAGGG - Intronic
1078079968 11:8197010-8197032 AACTCAGCTCCCTGTGTGCAGGG - Intergenic
1078581368 11:12541983-12542005 ATCACAGCACCCTCTGAGGTAGG + Intergenic
1078903893 11:15666565-15666587 AAAACTGTGCCCTCTGAGAATGG - Intergenic
1080036530 11:27718427-27718449 AAAACAGCACCATCTGGGAAGGG + Intronic
1081127763 11:39341606-39341628 ATCATAGCTCCCTGGGAGAAGGG - Intergenic
1084953733 11:72680501-72680523 AACACAGGTCCCTCTCAGATGGG - Intergenic
1085516916 11:77116868-77116890 AACACAGCTGTGTTTGAGAAGGG + Intronic
1085517088 11:77118029-77118051 AACACAGCTGGCTTTGAGAGGGG - Intronic
1086762776 11:90653903-90653925 ATTACAGTTCCCTTTGAGAAAGG - Intergenic
1090129187 11:124121876-124121898 AAACCAGCTGTCTCTGAGAATGG + Intronic
1092335014 12:7624698-7624720 AACCCTGCTCCCTGTGAGCATGG + Intergenic
1092396742 12:8133922-8133944 GACACTGGTCCCCCTGAGAAAGG + Intronic
1093144280 12:15545622-15545644 AACACAGCTTCCTTTACGAATGG + Intronic
1096198980 12:49667633-49667655 ATCACAGAACCCTCTGAGGAAGG - Intronic
1096218199 12:49809902-49809924 AAGACAGATGCCTCTCAGAAGGG - Intronic
1097118451 12:56716422-56716444 ATCACAGCTCCCACTCGGAAAGG - Intronic
1097905252 12:64912845-64912867 AAGACAGCTCCCTTTGGAAAGGG - Intergenic
1099736834 12:86578258-86578280 ACCACATGTCCTTCTGAGAAAGG - Intronic
1100364866 12:93910836-93910858 TACGCAGCTCCTTCTGAGAAAGG - Intergenic
1102952028 12:117037495-117037517 AACACATCTGCCTTTGAGAAGGG + Intergenic
1103333799 12:120173953-120173975 GACACACCTCCCTCAGAGCAAGG - Intronic
1105660145 13:22485048-22485070 GACACAGCTCTATCTGAGGATGG + Intergenic
1105926173 13:25010853-25010875 AACAAAGCTCCTTCTGAAATTGG - Intergenic
1108474049 13:50796082-50796104 AACATAGCTCCCTCAGATAAGGG - Intronic
1109814063 13:67556129-67556151 AACACAGAGCTCTGTGAGAATGG - Intergenic
1110785701 13:79523108-79523130 AACACATCTCCCTTGGATAAGGG - Intronic
1111907586 13:94272962-94272984 GACACAGCCCCCTCTCAGTAAGG + Intronic
1112919309 13:104591593-104591615 AGCACCATTCCCTCTGAGAAGGG + Intergenic
1118616515 14:67577889-67577911 AGCAGTGCTCCCTCTTAGAAAGG + Intronic
1119533396 14:75379629-75379651 AACACAGTTATCTTTGAGAATGG + Intergenic
1121922263 14:97892996-97893018 AACATAGGGCCCTCTGAGTAAGG + Intergenic
1122314439 14:100817525-100817547 AACGCTGCGCCCTCTGAGACAGG - Intergenic
1122723071 14:103732816-103732838 CACAGAGCTTCCTCTGGGAAAGG - Intronic
1124209450 15:27751048-27751070 GCCACAGGTCCCTCTGAGGAAGG - Intergenic
1124270523 15:28276352-28276374 AACACAAGAACCTCTGAGAAGGG + Intronic
1124924320 15:34056411-34056433 AACAGACATTCCTCTGAGAAAGG + Intronic
1125325310 15:38530518-38530540 AACACTGCTACCTGTGAGGAAGG - Intronic
1125757858 15:42076765-42076787 AACACAACTCCTTTGGAGAATGG + Intronic
1128984315 15:72208072-72208094 CACACATCTTCCTCTGAGAGTGG + Intronic
1129069871 15:72941875-72941897 AACATATCTACCTATGAGAAAGG + Intergenic
1129868366 15:78925648-78925670 AACCCTGCACCCTCTGAGATAGG + Intronic
1130668568 15:85890480-85890502 GACCCAGCTCCCTCTCAGGATGG - Intergenic
1131666583 15:94577414-94577436 AACACACCTGATTCTGAGAAGGG - Intergenic
1132948623 16:2547322-2547344 TACACAGCTCCTTCAGAGCACGG + Intronic
1132965964 16:2654805-2654827 TACACAGCTCCTTCAGAGCACGG - Intergenic
1133270814 16:4610070-4610092 AACACAGAGCCTTCCGAGAATGG - Intronic
1134534491 16:15014776-15014798 AACTAAGCTCTCTCTGAAAAGGG + Intronic
1135949104 16:26896215-26896237 AAGACTGCTTCTTCTGAGAAAGG - Intergenic
1136640888 16:31564167-31564189 AACACAGTCTCCTCTGGGAAGGG - Intergenic
1136664078 16:31793147-31793169 AACACAGTCTCCTCTGGGAAGGG + Intronic
1139861553 16:70026001-70026023 AACTAAGCTCTCTCTGAAAAGGG - Intergenic
1142233249 16:88909644-88909666 CCCACAGCTTCCTCTGGGAAAGG + Intronic
1144389348 17:14779265-14779287 CACACAGCTCCCTTTGAAACTGG - Intergenic
1146507849 17:33421098-33421120 CACCCTGCTCTCTCTGAGAAAGG - Intronic
1147656733 17:42095413-42095435 GGCGCAGCTCCCTCTGAGAAGGG + Intergenic
1147687742 17:42297305-42297327 AGGGCAGCTCCTTCTGAGAATGG + Intronic
1149008647 17:51832084-51832106 AACCCAGGTCTCTCTGACAATGG - Intronic
1150958599 17:69889920-69889942 AACACACCTTCTTCAGAGAAGGG + Intergenic
1151033284 17:70767389-70767411 AACACAGCTACCTCAGGAAAGGG + Intergenic
1152096943 17:78278112-78278134 AGCCCACCTCCCTCTGAGTATGG - Intergenic
1153526494 18:5999459-5999481 AGCACAGCACACTCTGAGGAAGG - Intronic
1154015854 18:10616503-10616525 AACAGAGTTCCCCATGAGAATGG - Intergenic
1155593958 18:27460893-27460915 AACACAGCTTTCCCTGTGAAAGG - Intergenic
1156282358 18:35652360-35652382 AAAACAGACCCCTCTGAGAGAGG - Intronic
1158716300 18:59882676-59882698 AATGCACCTCCCTCTGGGAATGG + Intergenic
1159015389 18:63098205-63098227 AACACAGCCCCATTCGAGAAAGG - Intergenic
1160204988 18:76824133-76824155 AACACAGGTGCCCCAGAGAAAGG + Intronic
1160311256 18:77792908-77792930 AGCACAGATATCTCTGAGAAAGG - Intergenic
1160473400 18:79160220-79160242 AACACAGCTCACTCTTAGCTAGG + Intronic
1161121358 19:2528650-2528672 ACCACAGCTCCCACAGAGGAGGG + Intronic
1164896054 19:31878653-31878675 TACACAGCACGCTCTGAGCAAGG - Intergenic
1165392859 19:35548308-35548330 GACACATCCCCCTCAGAGAAAGG - Intergenic
1166038762 19:40189953-40189975 AACCCACTTCCCTCTGACAATGG + Intergenic
1166256107 19:41606073-41606095 AACACATGTCCCTCAGAGGATGG + Intronic
1166601634 19:44100863-44100885 GATACAGCTTCCTCTGAGCAAGG - Exonic
926424020 2:12725168-12725190 AACACAGATCCCTGCGAGAGAGG - Intronic
926809711 2:16745514-16745536 ATGACAGCCCCCTCTGAGCATGG + Intergenic
926946484 2:18193078-18193100 AACACACGTCTCTCTGAGGAAGG - Intronic
929415516 2:41743177-41743199 AACTCAGCTCCCTCAAAAAAGGG + Intergenic
930402129 2:50903711-50903733 AACACAGCTCCCTTTGCCTAAGG - Intronic
930807732 2:55508096-55508118 AAAACAGATCCTTCTCAGAATGG + Intergenic
931534626 2:63260167-63260189 AACACAACTCTCTCTGACAATGG + Intronic
931711853 2:64994595-64994617 AGCACACCTCCCTCTGTGAAGGG - Intronic
932472505 2:71970012-71970034 AATACTGTTCCCTCTGAGAGTGG - Intergenic
932544912 2:72698237-72698259 ATCACCGCTTCCTCTGAGAATGG + Intronic
933636983 2:84719462-84719484 AAGAGAGCTGCCTCTGTGAAGGG - Intronic
933902640 2:86860967-86860989 ACATCAGGTCCCTCTGAGAATGG - Intronic
934818629 2:97352713-97352735 CTCACTGCTCTCTCTGAGAAAGG - Intergenic
935777908 2:106488301-106488323 ACATCAGGTCCCTCTGAGAATGG + Intergenic
936024724 2:109022332-109022354 AACACTGCTCCCCCTGGGGAAGG - Intergenic
936547320 2:113403936-113403958 CTCACTGCTCTCTCTGAGAAAGG - Intergenic
937909918 2:127070506-127070528 ACCAGAGGGCCCTCTGAGAAGGG + Intronic
938187292 2:129242979-129243001 CACAAAGCTCCCTCTGGGTAGGG + Intergenic
940540508 2:155010132-155010154 ACCACAGGTCCCACTGAGGAAGG + Intergenic
940558183 2:155259248-155259270 AATGCAGCCCCCTCTGATAAGGG + Intergenic
942439807 2:176020655-176020677 AACCCAGCTGCCTATGAAAATGG + Intergenic
942495442 2:176535003-176535025 TACAGAGCTGCCACTGAGAAAGG - Intergenic
946075109 2:217067256-217067278 AATTCAGCTCCCTGTGAGGAAGG + Intergenic
946439271 2:219681322-219681344 ATCTGAGCTCCCTCTGGGAAGGG - Intergenic
947513765 2:230783412-230783434 AACAGACTTCCCTCTAAGAACGG - Intronic
947533423 2:230926638-230926660 GACAAGGCTCCCTTTGAGAAGGG - Intronic
1173361704 20:42350499-42350521 AACAAAGCTTCCTCGGAGGAAGG - Intronic
1173475073 20:43353164-43353186 AACACAGCATCCTATGTGAAGGG - Intergenic
1177500325 21:21946585-21946607 CACACAGCTAACTTTGAGAAAGG + Intergenic
1182204314 22:28608383-28608405 CACACAGCTACCTCTGAGTTAGG - Intronic
1182997498 22:34827656-34827678 ACCAGAGCTCCCTGTGGGAAGGG - Intergenic
1183868549 22:40723411-40723433 AAAAAAGATCCCTCTGGGAATGG + Intergenic
1184333764 22:43841474-43841496 TACCCAGCTCCCTCAGAGGAGGG + Intronic
949408631 3:3740658-3740680 CACATTGCTCCCTCTTAGAAAGG - Intronic
950137373 3:10591105-10591127 AAGACATCTTCCTCTCAGAAGGG - Intronic
950182104 3:10920959-10920981 AGCCCAGGTCCTTCTGAGAAAGG - Intronic
951003732 3:17593660-17593682 CACACAGCACCCTCTGACCAAGG + Intronic
951863647 3:27282000-27282022 AACAAAACTACCTATGAGAAAGG + Intronic
953850094 3:46459506-46459528 AGCACAGTTCCCTGTGAGAGAGG + Intronic
955203638 3:56875831-56875853 AACACAGCCCTCCCTGTGAAGGG + Intronic
955443880 3:58986468-58986490 ATTACTGCTCCCTCTGTGAAAGG + Intronic
955591958 3:60546597-60546619 CCCACAGCTGCCTGTGAGAAGGG - Intronic
959620330 3:108392990-108393012 AATCCAGCCCCCTCTAAGAATGG - Intronic
966791119 3:183670656-183670678 AATACTGCTCACACTGAGAATGG - Intronic
967090714 3:186132696-186132718 AACACAGCAGCCTCAGAGACTGG - Intronic
969888528 4:10238376-10238398 AATGCAACTGCCTCTGAGAAGGG + Intergenic
970692588 4:18636632-18636654 AACACAGATCTCCCTGGGAATGG - Intergenic
971174637 4:24270067-24270089 AACACAGCCCACACTGAGGAGGG - Intergenic
971649930 4:29258489-29258511 AACAAAGCTCTCTCCTAGAATGG - Intergenic
972366322 4:38378403-38378425 AACAAAACTCCCTGTGTGAATGG - Intergenic
975926836 4:79465627-79465649 AGCACAGATTCCACTGAGAAGGG - Intergenic
978409632 4:108412495-108412517 AGCACATCTTCCTCTGGGAAAGG + Intergenic
979841165 4:125442203-125442225 AATAAAGCTTCCTCAGAGAAAGG - Intronic
981641367 4:146946995-146947017 AAGACAGCCTCCTGTGAGAAAGG - Intergenic
984756826 4:183332393-183332415 TTCACAGCTGCCTCTGAAAATGG - Intergenic
985539373 5:480772-480794 AACACAGATCGCTCAGAAAATGG + Intronic
987441022 5:17956660-17956682 TTGAGAGCTCCCTCTGAGAAGGG + Intergenic
990338667 5:54801108-54801130 AACCCAAAGCCCTCTGAGAATGG + Intergenic
991213861 5:64138148-64138170 AACACAGCAAACTCTGGGAAGGG + Intergenic
991944075 5:71882809-71882831 GACACAGCTCCCTCTGGCCAGGG - Intergenic
992007587 5:72493299-72493321 ATCACAGCACCCTCTGAGGTAGG + Intronic
992537716 5:77727429-77727451 AACACAGCTCCATCAGAACATGG - Intronic
992775241 5:80083335-80083357 AACAGGGATCCCTCCGAGAACGG - Intergenic
994077586 5:95670628-95670650 CACAAAGCTCCATCTGAGACAGG + Intronic
994084969 5:95748363-95748385 AACACAGCTCCCTCTGTCTGAGG - Exonic
994776805 5:104045090-104045112 AAGACAGCTTTCTCTGAGGATGG + Intergenic
995463788 5:112429984-112430006 AAAACAGCTCTCAATGAGAAAGG - Intergenic
997661334 5:135591481-135591503 AACACAGCTGCCACTGAAATTGG - Intergenic
998173045 5:139883491-139883513 CAGACAGCACCCTCTGAGGAGGG + Intronic
998486507 5:142507322-142507344 GACACAGCTCACACTGAAAATGG - Intergenic
999226007 5:150025301-150025323 AACACAACTTCCTCAGGGAAGGG - Intronic
1000735542 5:164894542-164894564 ACCACACCTCCCTTTGAGGAAGG + Intergenic
1002184804 5:177449343-177449365 AACAGAACTCCCTCTGATGAGGG - Intronic
1002938850 6:1698658-1698680 AGCACAGCCCACTCTGAGAAGGG + Intronic
1006028887 6:31164752-31164774 GACACTGGTCCCCCTGAGAAAGG + Exonic
1006103112 6:31699034-31699056 AACACAGCCACCTCTCAGCAGGG + Intronic
1006578458 6:35062693-35062715 CACACAGCTCCCTCTCAGAGTGG + Intronic
1006836184 6:37000087-37000109 TACAGATCTCCCTCTGAGCAGGG - Intergenic
1006993155 6:38232900-38232922 AACACAGCATCCTCTGGGAAGGG - Intronic
1007725778 6:43914888-43914910 AAATCAGTTCCCTCTGAGCAAGG + Intergenic
1007998090 6:46329929-46329951 ACCACAGCTTCCTCTGGGATTGG - Intronic
1008621260 6:53273646-53273668 AAAACAGCTGTCTCTGAGAGTGG - Intronic
1008646069 6:53516328-53516350 AACACAAAGCCCTCTGAAAAGGG - Intronic
1010408191 6:75529783-75529805 AATCCAGCTCCCTTTGACAAAGG + Intergenic
1012010950 6:93784564-93784586 AACAAAACTCCCTGAGAGAAGGG + Intergenic
1012473464 6:99596153-99596175 TACACCGCTGTCTCTGAGAATGG - Intergenic
1014375653 6:120669667-120669689 AACACAGTTTACTCTGAAAAGGG + Intergenic
1018582333 6:165317818-165317840 GACACAGCGGCCTTTGAGAAGGG + Intergenic
1018827345 6:167419419-167419441 AAAACAGTTGCATCTGAGAATGG - Intergenic
1018910178 6:168097243-168097265 AACACAGCTCACACTGCGACTGG + Intergenic
1019894503 7:3973095-3973117 AACCCAGTTCCATCTGAGGAAGG - Intronic
1022532453 7:31075587-31075609 GAGACAGCTCACTTTGAGAAGGG - Intronic
1023984518 7:45087068-45087090 AACACACCTCCAGCTGAGAAAGG + Intronic
1024640785 7:51327051-51327073 GGCACAGCTCCCTCTGAGATTGG - Intergenic
1025212108 7:57025739-57025761 AACACAGCTCCCTCTGAGAAGGG - Intergenic
1025659846 7:63551089-63551111 AACACAGCTCCCTCTGAGAAGGG + Intergenic
1029675286 7:102064494-102064516 AACACAGCTCCCTCTGAGAAGGG - Intronic
1029747600 7:102525172-102525194 CACACTGCTCCCACTGAGACTGG + Intergenic
1029765551 7:102624262-102624284 CACACTGCTCCCACTGAGACTGG + Exonic
1032397842 7:131603432-131603454 AACACAGTTTCCTCTGAAAATGG - Intergenic
1032474032 7:132200182-132200204 AACATATCTCCCTGTGACAAAGG - Intronic
1032485828 7:132286807-132286829 AACATAGCTCTCTCTGATTAGGG + Intronic
1033829152 7:145231579-145231601 AACTCATCTACCTCTGAGAAAGG + Intergenic
1034295584 7:149969253-149969275 CACACAGCTCTTTCTGAGGATGG - Intergenic
1037612014 8:20483774-20483796 AACCCAGCTCTCACTGAGGATGG - Intergenic
1038413532 8:27376274-27376296 AAGACTGCTCCCTCCCAGAACGG - Intronic
1038502213 8:28054660-28054682 AACACAGCAGCCTGTGTGAACGG + Intronic
1038652103 8:29414108-29414130 AACATATCTCCCTCAGATAAGGG + Intergenic
1040846602 8:51849109-51849131 TACATAGCTGCTTCTGAGAAAGG + Intronic
1044834694 8:96284923-96284945 CACACAGCTCACTCAGTGAATGG - Intronic
1045862443 8:106828472-106828494 AACAAAACTCCCTCAGATAACGG + Intergenic
1047697394 8:127416773-127416795 GACACTGGTCCCCCTGAGAAAGG - Exonic
1050123546 9:2332748-2332770 AACACATGTCCCTCTTGGAATGG + Intergenic
1050314377 9:4386200-4386222 ACCAAAGCTCCTTCTGAGTAGGG - Intergenic
1051822100 9:21180704-21180726 AACAGAGTTCCCAGTGAGAAGGG + Intergenic
1051823332 9:21192766-21192788 AACAGAGCTCCCAGTGAGAAGGG + Intergenic
1051825152 9:21211302-21211324 AACAGAGCTCCCAGTGAAAATGG + Intronic
1051827135 9:21233365-21233387 AACAGAGCTCCCAGTGAGAAGGG + Intronic
1052777757 9:32750715-32750737 AACAAAGCTCCATCTCAGAAAGG + Intergenic
1055143090 9:72899016-72899038 AACACAACTCCCTCTGTGTTTGG + Intergenic
1055499005 9:76884843-76884865 AACACAGCTCCTACTTAGAAAGG + Intronic
1057117826 9:92542193-92542215 AATACATCTCCCTTTAAGAAAGG - Intronic
1057440454 9:95079162-95079184 GCCACAGTGCCCTCTGAGAACGG - Intronic
1058074502 9:100637305-100637327 AACACAGCTCCTTGTCAGCAAGG - Intergenic
1060665491 9:125429956-125429978 ATCACACCTCTCACTGAGAACGG + Intergenic
1186282708 X:8010624-8010646 AAGACAGATCCCTCCAAGAAGGG + Intergenic
1195702661 X:107716602-107716624 CACACAGCTCGCTCAGAGACCGG + Intronic
1195796398 X:108652990-108653012 GACACAAATCACTCTGAGAAAGG - Intronic
1195909192 X:109872206-109872228 AACACAGCTCTCTCTGGCAAAGG + Intergenic
1198056410 X:133000001-133000023 AATGCAGCTCCCTCAGAGAGTGG - Intergenic
1200738563 Y:6828286-6828308 AAGACAGATGCCTCTGAGATGGG - Intergenic
1201223101 Y:11790312-11790334 AAAACAGCTTCTTCTGAGATGGG + Intergenic
1202103565 Y:21337365-21337387 AACACAACTCCCACTAAGATAGG + Intergenic