ID: 1025659847

View in Genome Browser
Species Human (GRCh38)
Location 7:63551090-63551112
Sequence ACACAGCTCCCTCTGAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 3, 1: 0, 2: 2, 3: 23, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659844_1025659847 -10 Left 1025659844 7:63551077-63551099 CCAAGGCTTGGTAACACAGCTCC No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659838_1025659847 19 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659834_1025659847 25 Left 1025659834 7:63551042-63551064 CCCAGCCCGTCCACTGCATGCCT No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659835_1025659847 24 Left 1025659835 7:63551043-63551065 CCAGCCCGTCCACTGCATGCCTT No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659837_1025659847 20 Left 1025659837 7:63551047-63551069 CCCGTCCACTGCATGCCTTGGAG No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659842_1025659847 5 Left 1025659842 7:63551062-63551084 CCTTGGAGGTGCAAGCCAAGGCT No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259
1025659840_1025659847 15 Left 1025659840 7:63551052-63551074 CCACTGCATGCCTTGGAGGTGCA No data
Right 1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG 0: 3
1: 0
2: 2
3: 23
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659847 Original CRISPR ACACAGCTCCCTCTGAGAAG GGG Intergenic
903186842 1:21633887-21633909 ACAGACCTCCCAGTGAGAAGAGG + Intronic
903418539 1:23201503-23201525 ACACAGCAGCCTCTGAGAAATGG + Intergenic
904409854 1:30318979-30319001 ACACAGACACCACTGAGAAGTGG + Intergenic
910771116 1:90833671-90833693 ACCCAGCTCCCAGTGAGCAGGGG - Intergenic
911159458 1:94670124-94670146 AGACAGTCCTCTCTGAGAAGAGG - Intergenic
915136227 1:153733579-153733601 ATACTGCTCCCTATGGGAAGTGG - Intronic
915440275 1:155941546-155941568 ACACCCCTCCCTCTGAGGTGTGG + Intergenic
915534258 1:156525327-156525349 ACACAGCTCCCTGAGAGAACTGG - Intergenic
917853391 1:179083310-179083332 AAACAGCTACCTCTCAGAGGGGG + Intronic
919660692 1:200242312-200242334 ACACACCCCCATCAGAGAAGAGG + Intergenic
919724825 1:200874659-200874681 ACACTTCTCCCCCTGTGAAGCGG + Intergenic
919806318 1:201382880-201382902 ACACAGCTCCCTGGGGGAAGGGG - Intronic
920310332 1:205044549-205044571 TCCCAGCTCCTTCTGAGCAGAGG - Intronic
921108496 1:212009024-212009046 ACAAAGATCCCTCTGAGTACTGG - Intronic
921198179 1:212779362-212779384 CCCCACCTCCCTCTGAGATGGGG - Intronic
921333743 1:214065695-214065717 ACACAGCTCCAGTGGAGAAGGGG - Intergenic
921476523 1:215616959-215616981 ACCCAGCAACCTTTGAGAAGGGG + Intronic
924325594 1:242891322-242891344 AAACAGCTTCTTCTGAGACGGGG + Intergenic
924838093 1:247675633-247675655 ACACAGTTCACTGTGAGGAGAGG + Intergenic
1064625303 10:17255220-17255242 TCAGAGCTCCCTTTGAGAAATGG - Intergenic
1064874214 10:19975034-19975056 AAACAGTTGCCTCTGGGAAGTGG - Intronic
1065779992 10:29158302-29158324 ACTCAGCTTCTTCTTAGAAGAGG + Intergenic
1067535248 10:47104732-47104754 ATTCACATCCCTCTGAGAAGGGG + Intergenic
1067748568 10:48955447-48955469 ACTCAGCTCTTTCTGAGAGGGGG - Intronic
1073036593 10:100567990-100568012 TCACAGTCCCTTCTGAGAAGTGG + Intergenic
1074853485 10:117456949-117456971 GCACAGAGCCCTCTAAGAAGTGG + Intergenic
1075740621 10:124693843-124693865 AGAAAGCTCCCTGAGAGAAGGGG + Intronic
1075889362 10:125932781-125932803 AAAGCACTCCCTCTGAGAAGGGG - Intronic
1076543725 10:131230245-131230267 TCACAGCTGCCTCTGTGGAGGGG - Intronic
1076655334 10:132019865-132019887 ACAGAGCTCCTGCTCAGAAGGGG + Intergenic
1076947569 10:133661926-133661948 ACGCAGAGCCCTCAGAGAAGTGG + Intergenic
1078630975 11:13004061-13004083 ACACAGTTCCCTCTGACATCTGG - Intergenic
1079082127 11:17420982-17421004 ACACAGTTCTCTCTGAGACCAGG + Intronic
1081460484 11:43268303-43268325 ACACTGATGCCTTTGAGAAGGGG + Intergenic
1081718394 11:45267788-45267810 ACACAGTTCACTCTGCAAAGGGG + Intronic
1083460307 11:62806727-62806749 ACACAGCTGCCTCTAGGCAGGGG - Intergenic
1084010510 11:66345942-66345964 CCACAGCTACCTCTGTAAAGTGG + Exonic
1084433271 11:69123220-69123242 AGTCAGCTCCCTGTGAGAGGCGG + Intergenic
1084953732 11:72680500-72680522 ACACAGGTCCCTCTCAGATGGGG - Intergenic
1085563202 11:77490263-77490285 CCCCACCTCCCTCTGAGACGGGG - Intergenic
1086946649 11:92850386-92850408 ACACAGCTGCCCCAGAGAGGAGG + Intronic
1087278068 11:96180259-96180281 ACACTCCTCCCCCTGAGAGGTGG + Intronic
1088816116 11:113422112-113422134 ACACACGTTCCTCTGGGAAGAGG + Intronic
1089041592 11:115455921-115455943 AATAAGTTCCCTCTGAGAAGTGG + Intronic
1089715415 11:120354126-120354148 ACAGAGATGCCTGTGAGAAGAGG + Intronic
1090587211 11:128226263-128226285 ACCCATCTCCCTCTATGAAGAGG + Intergenic
1090933751 11:131323674-131323696 ACATAGCTCACTCTGTGATGAGG + Intergenic
1091641140 12:2238614-2238636 ACCAAGTGCCCTCTGAGAAGAGG + Intronic
1092023440 12:5221673-5221695 ACACAGCTCCCTCTGGCTGGTGG + Intergenic
1093434078 12:19115509-19115531 TCACAGGTCCCTCTGAGTACAGG - Intergenic
1094571604 12:31645943-31645965 TCACATCTGCCTCTGAGCAGGGG - Intergenic
1096402747 12:51320836-51320858 TCTCAGATCCCCCTGAGAAGGGG - Intronic
1096493150 12:52023777-52023799 CCACAGCACCCTGTGAGGAGCGG - Intronic
1097157453 12:57023252-57023274 GCGCAGCTCCCTCTGGGAGGGGG - Intronic
1097484693 12:60181110-60181132 AGACAGCTCCTTCTCAGATGAGG + Intergenic
1097905251 12:64912844-64912866 AGACAGCTCCCTTTGGAAAGGGG - Intergenic
1098409475 12:70165323-70165345 ATACAGATCCCTGAGAGAAGAGG + Intergenic
1099440210 12:82689076-82689098 ACACAGCATGCTCTGAGAAATGG + Intronic
1099869888 12:88333646-88333668 CTACAGCTCTCTCAGAGAAGAGG + Intergenic
1101997719 12:109536945-109536967 TGACAGCTGCCTCTGGGAAGTGG - Intergenic
1102759601 12:115374209-115374231 CCACAGCTCCCACTGCCAAGTGG + Intergenic
1106218263 13:27722154-27722176 ACACAGCTGCCTCTGCTCAGTGG + Intergenic
1106901745 13:34360860-34360882 ACAGAGCTGCCTCTGGGAAGAGG - Intergenic
1106911723 13:34470241-34470263 AAACAGCTCTCTCTGGGAAATGG - Intergenic
1108474048 13:50796081-50796103 ACATAGCTCCCTCAGATAAGGGG - Intronic
1110785700 13:79523107-79523129 ACACATCTCCCTTGGATAAGGGG - Intronic
1111995405 13:95160786-95160808 ACAAAGATCCCTCTGAAAAATGG + Intronic
1112578761 13:100660479-100660501 ACATAGATCCCTGTGAGATGAGG - Intronic
1116864045 14:50017097-50017119 AGACAGCTCACAATGAGAAGAGG + Intergenic
1117210531 14:53493826-53493848 ACACAGGTGCCTTTGAAAAGAGG - Intergenic
1117462201 14:55956364-55956386 TCACTCCTTCCTCTGAGAAGAGG + Intergenic
1118853907 14:69606437-69606459 ACAAAGCTCCCTCCGACCAGTGG + Intergenic
1119775144 14:77243504-77243526 ACGCAGCCCTCTCAGAGAAGTGG + Intronic
1119810436 14:77513467-77513489 ACAGCGGTACCTCTGAGAAGAGG + Intronic
1120149186 14:81014143-81014165 AAACAGCTACCTCTCACAAGAGG - Intronic
1120182226 14:81355540-81355562 ACAAAGCTGCCTCTGAAATGAGG + Intronic
1121353892 14:93196834-93196856 GCACAACTACCTCTGGGAAGAGG - Intronic
1121443809 14:93966021-93966043 ACCCAGATCCTTCTGGGAAGAGG + Intronic
1121738029 14:96232219-96232241 ACACAGCACCCTAGGAGATGGGG + Intronic
1121826895 14:97017515-97017537 ACACTGCTCCTGCTGTGAAGAGG + Intergenic
1123113707 14:105884414-105884436 ACACAGCGGCCTCTCAGAAGAGG + Intergenic
1123115934 14:105894053-105894075 ACACAGCGGCCTCTCAGAGGAGG + Intergenic
1123117961 14:105903163-105903185 ACACAGCGGCCTCTCAGAGGAGG + Intergenic
1123120173 14:105912768-105912790 ACACAGCGGCCTCTCAGAGGAGG + Intergenic
1123796602 15:23778448-23778470 ACTCAGCTCTGTCTGGGAAGAGG - Intergenic
1124666333 15:31595973-31595995 ACACAGGGCCCTGAGAGAAGAGG - Intronic
1126704354 15:51393861-51393883 TCACAGCTCCCTGTGAACAGAGG + Intronic
1127924351 15:63524391-63524413 ATACTGCTCCCTCTGTTAAGTGG + Intronic
1128671595 15:69578054-69578076 ACATCGCCTCCTCTGAGAAGCGG - Intergenic
1129890429 15:79068145-79068167 CCTCAGCCCCCTCTGTGAAGTGG - Intronic
1130725499 15:86434827-86434849 ACATAGCTTCCTCTCAGAAGAGG + Intronic
1131942890 15:97586065-97586087 ATACAGCTCCCACTTAAAAGTGG + Intergenic
1132726150 16:1339158-1339180 ACACAGGTCCCCCTGCGCAGTGG + Exonic
1132948624 16:2547323-2547345 ACACAGCTCCTTCAGAGCACGGG + Intronic
1132965963 16:2654804-2654826 ACACAGCTCCTTCAGAGCACGGG - Intergenic
1134839300 16:17388818-17388840 ACACAGCCCCTCCTGAGAAAAGG - Intronic
1134843823 16:17423333-17423355 ACTCAGCTGCCCCTGAGGAGTGG - Intronic
1135338988 16:21630335-21630357 TCACACCTCCCTGTGAGCAGAGG + Intronic
1136145583 16:28314594-28314616 CCACAGCTCCCTCTGGGAGAAGG - Intronic
1136558776 16:31025916-31025938 ACACAGCTCACAGGGAGAAGGGG + Intergenic
1137246458 16:46709917-46709939 TCTCAGCCCCCTCTGGGAAGTGG - Intronic
1137489919 16:48923758-48923780 ACCAAGCTCCCTCTAGGAAGTGG - Intergenic
1137692798 16:50441166-50441188 CCACCGCGCCCTCTCAGAAGTGG - Intergenic
1138342961 16:56302691-56302713 TCAAAGCACCTTCTGAGAAGAGG - Intronic
1138932622 16:61678857-61678879 TCACAGCTCCTTATGAAAAGTGG - Intronic
1139302132 16:65954392-65954414 AAACAGCTTCCTCAGGGAAGTGG - Intergenic
1140026408 16:71294341-71294363 ACACACCACCCTCTGAAGAGTGG + Intergenic
1140220229 16:73038335-73038357 GCACAGCTGCAGCTGAGAAGCGG - Intronic
1141473497 16:84255426-84255448 ACATTCCTCCCACTGAGAAGTGG - Intergenic
1142032440 16:87845286-87845308 TCACAGCCCCCTCTTAGATGAGG - Intronic
1143266349 17:5640874-5640896 ACATTCCTCCCACTGAGAAGTGG - Intergenic
1143978988 17:10851720-10851742 ATAAACCTCCTTCTGAGAAGTGG - Intergenic
1144209495 17:13002620-13002642 AGGCAGCTCCCCCTGAGGAGTGG + Intronic
1144448574 17:15355017-15355039 ACACAGCTCCCTCGCTGCAGTGG - Intergenic
1145750869 17:27354124-27354146 GCACAGCCCACCCTGAGAAGTGG + Intergenic
1146167582 17:30601447-30601469 ACTCAGGTCTCTCTGAGGAGAGG + Intergenic
1147374057 17:40013754-40013776 ACCCAGCTCCCTGGGAGTAGAGG - Intergenic
1147600177 17:41740327-41740349 CCACAGCACCCTCTGTGAGGAGG + Intergenic
1147905272 17:43818455-43818477 TCTCAGCTCCCTCAGAGATGGGG - Intronic
1148676049 17:49445678-49445700 ACACAGCCCCCTCTGTGAAGCGG + Intronic
1149826997 17:59837769-59837791 AGACCGCCCCCTCTGAGAAGAGG + Intronic
1151033285 17:70767390-70767412 ACACAGCTACCTCAGGAAAGGGG + Intergenic
1151232218 17:72693235-72693257 ACACAGCTTCCTGGGACAAGAGG - Intronic
1152550225 17:81026051-81026073 ACACAGCTGCCTCTGGCTAGGGG - Intergenic
1155523350 18:26691244-26691266 ACACAGAGCCCACTGAGAGGTGG + Intergenic
1155967034 18:32045653-32045675 ATACAGTTCCCTCTGACAAAAGG - Exonic
1156877322 18:42030728-42030750 ACACAGCCACCTCTGGGGAGAGG - Intronic
1157326638 18:46673908-46673930 CCAGAGCACCCTCTGGGAAGAGG - Intronic
1164593320 19:29518011-29518033 ACCCAGTGCCCTCTGAGCAGAGG + Intergenic
1164896053 19:31878652-31878674 ACACAGCACGCTCTGAGCAAGGG - Intergenic
1165156196 19:33790080-33790102 ACACAGTTCTTTCTGGGAAGGGG + Intergenic
1166204782 19:41262596-41262618 ACACAGCACCCACTCAGCAGCGG - Intronic
1168475264 19:56670552-56670574 ACGTAGCTCCCTGTGTGAAGAGG + Intronic
925009817 2:474894-474916 ATACATCTCCCTCTCAGAACTGG - Intergenic
926988264 2:18647963-18647985 ACACATCTCCCTCTGGGACTTGG + Intergenic
927216712 2:20671526-20671548 ACCCAGCACCCTCTCAGAGGAGG + Exonic
927432696 2:23040543-23040565 ACAGGGTTCCCTCTGAGCAGCGG + Intergenic
929415517 2:41743178-41743200 ACTCAGCTCCCTCAAAAAAGGGG + Intergenic
930747500 2:54900046-54900068 CCACAGCTCTCAATGAGAAGAGG - Intronic
932442823 2:71748556-71748578 ACACAGCTTCCCCTGGGAGGCGG - Intergenic
933088012 2:78080648-78080670 ACACATCACCCTCAGAGAATTGG + Intergenic
933452710 2:82477194-82477216 ACACGGCTCCATCTTGGAAGTGG + Intergenic
935070792 2:99692018-99692040 AAACAGCTGCCTCCAAGAAGGGG - Intronic
935915079 2:107940565-107940587 TCAGAACTCTCTCTGAGAAGAGG - Intergenic
936384177 2:112013748-112013770 ACACAGATCCCTGTGAGTGGCGG + Intronic
938369781 2:130761953-130761975 ACACAGCTCACTCTCTGCAGGGG - Intronic
939009514 2:136829403-136829425 AGAAAGCTCCCACAGAGAAGAGG - Intronic
940558184 2:155259249-155259271 ATGCAGCCCCCTCTGATAAGGGG + Intergenic
941020164 2:160399241-160399263 ACACAGATCCCTCTGACAAATGG + Intronic
942495441 2:176535002-176535024 ACAGAGCTGCCACTGAGAAAGGG - Intergenic
944767660 2:202880921-202880943 ACACAGCTACTTCTGAGTGGAGG - Exonic
945284153 2:208065584-208065606 ACACTGCTCCCATTGAGAAATGG + Intergenic
945820061 2:214653034-214653056 ACACAGAGCCAGCTGAGAAGAGG + Intergenic
946439270 2:219681321-219681343 TCTGAGCTCCCTCTGGGAAGGGG - Intergenic
946593788 2:221282620-221282642 ATTCAGCTCCCTGTGAGAACCGG - Intergenic
947533422 2:230926637-230926659 ACAAGGCTCCCTTTGAGAAGGGG - Intronic
947546305 2:231012716-231012738 ACAGAGCTGCCTAAGAGAAGTGG + Intronic
948672848 2:239579483-239579505 ACACACCTGCCTCTGAAAAGAGG - Intronic
948723989 2:239920576-239920598 ACACAGCTCCTTTTGGCAAGTGG - Intronic
1169519574 20:6356550-6356572 ACACAGCTGCCCCTGAGAGGAGG - Intergenic
1170361198 20:15548318-15548340 ACACTCCTCCCTTTGAGAGGAGG + Intronic
1171116893 20:22532544-22532566 TCACAGCTGCTTCTCAGAAGAGG - Intergenic
1172919609 20:38470171-38470193 ACACTCCTCCCACTGAGAAGTGG - Intergenic
1173128524 20:40364202-40364224 ACACAGCACTTTCTGAGATGTGG - Intergenic
1173669203 20:44786108-44786130 CTACAGCCCCCTTTGAGAAGAGG + Intronic
1174438447 20:50528980-50529002 ACACAGTTCTCGCTGAGAAATGG - Intronic
1175614000 20:60377166-60377188 TCACAGCACGCTCTTAGAAGGGG + Intergenic
1175684972 20:61022187-61022209 ACACAGCAACCTCTGAGAACAGG - Intergenic
1178261451 21:31103751-31103773 ACACAGAGACTTCTGAGAAGAGG - Intergenic
1179463136 21:41551091-41551113 AGGCAGCCCCTTCTGAGAAGAGG - Intergenic
1181759907 22:25051123-25051145 ACCCACCTACCTCTGAGGAGAGG - Intronic
1183210279 22:36447042-36447064 ACAGGCCTGCCTCTGAGAAGAGG - Intergenic
949408630 3:3740657-3740679 ACATTGCTCCCTCTTAGAAAGGG - Intronic
950364247 3:12471849-12471871 ATACATGTCCCTCTGAGCAGCGG + Intergenic
952770350 3:36994024-36994046 ACACAGTACCCTCTGAAAAAAGG - Intronic
953083016 3:39638726-39638748 ACCCACCTACCTCTGGGAAGGGG - Intergenic
953531569 3:43744589-43744611 TCACAGCCAACTCTGAGAAGTGG + Intergenic
953589158 3:44235019-44235041 ATACAGCCCCTCCTGAGAAGAGG + Intergenic
953686358 3:45081339-45081361 ACACCTCTCCCACTGAGATGGGG + Intergenic
954858335 3:53665945-53665967 ACATAGCTCACACTGAGAACTGG - Intronic
954892209 3:53941214-53941236 ACATATCCCCCTCAGAGAAGTGG - Intergenic
956878824 3:73490173-73490195 ACACCTCTCCCTCTGAAAGGTGG + Intronic
959928432 3:111952181-111952203 ACACAGATACCAGTGAGAAGAGG - Intronic
961643925 3:128382349-128382371 ACACAGCCTGCTCTGAGACGAGG - Intronic
961751999 3:129102109-129102131 ACAGTGGTCCCTCTGAGAGGTGG - Intronic
962016849 3:131449725-131449747 GAACATCTCTCTCTGAGAAGAGG - Intergenic
962533064 3:136301460-136301482 ACAAAACCCCCTCTGAGCAGAGG - Intronic
962828740 3:139121411-139121433 AAAGAGCTCACTCTGAAAAGAGG - Intronic
966973555 3:185066503-185066525 AATCAGCTCTCTCTGGGAAGAGG - Intergenic
967413239 3:189188292-189188314 ACTCACCTTTCTCTGAGAAGAGG - Intronic
968421302 4:487386-487408 AGACAGCTCACTCCCAGAAGCGG + Intronic
968447371 4:658499-658521 TCACGGCTCCCTCTGTGCAGTGG + Intronic
968578178 4:1377577-1377599 GCAAAGCTCCCACCGAGAAGCGG + Intronic
968725416 4:2245707-2245729 GCACAGCCTCCTCTGGGAAGTGG - Intergenic
971862188 4:32122158-32122180 ACAGAGCTCACTTTGAGAAAAGG + Intergenic
974841674 4:67306535-67306557 GTACAGCTGCCTCTGAGAGGTGG - Intergenic
978629163 4:110723267-110723289 AAAGCACTCCCTCTGAGAAGTGG - Intergenic
982474239 4:155831034-155831056 ACACAGCTTCCTCTAAGATGCGG + Intronic
983910040 4:173227656-173227678 ACACAGCACTCTATGTGAAGAGG - Intronic
984756825 4:183332392-183332414 TCACAGCTGCCTCTGAAAATGGG - Intergenic
985323008 4:188735276-188735298 CCACACCTCCCTGTGAGCAGAGG + Intergenic
985451025 4:190062723-190062745 ACGCAGAGCCCTCAGAGAAGTGG + Intergenic
987441023 5:17956661-17956683 TGAGAGCTCCCTCTGAGAAGGGG + Intergenic
988032711 5:25784563-25784585 ACACTGCTGGCACTGAGAAGTGG + Intergenic
989124894 5:38042961-38042983 ACACAGCTCACTCAGATATGTGG - Intergenic
989828980 5:45890976-45890998 ACCCACCTCCCTCTGGGATGGGG - Intergenic
991213862 5:64138149-64138171 ACACAGCAAACTCTGGGAAGGGG + Intergenic
991944074 5:71882808-71882830 ACACAGCTCCCTCTGGCCAGGGG - Intergenic
992277062 5:75131163-75131185 CCACACCTCCCCATGAGAAGAGG + Intronic
995705945 5:114989676-114989698 CCACACCTCCCCCTGAGCAGAGG - Intergenic
995707361 5:114999312-114999334 CCACACCTCCCTGTGAGCAGAGG - Intergenic
996679930 5:126220896-126220918 CCACACCTCCCTGTGAGCAGAGG - Intergenic
998061645 5:139123438-139123460 ACACACCTGCCTATGGGAAGGGG - Intronic
998173046 5:139883492-139883514 AGACAGCACCCTCTGAGGAGGGG + Intronic
1000132588 5:158314102-158314124 ACACAGTGCTCTCTGGGAAGAGG + Intergenic
1001530864 5:172460617-172460639 ACGCACATCCCTTTGAGAAGTGG - Intergenic
1004668862 6:17776687-17776709 ACTCAGCTGCTTCTGGGAAGTGG + Intronic
1005765067 6:29003512-29003534 ACCCAGCTCCCTCAGGAAAGCGG - Exonic
1006836183 6:37000086-37000108 ACAGATCTCCCTCTGAGCAGGGG - Intergenic
1006847715 6:37074341-37074363 ACACACCTGCCTCCAAGAAGAGG - Intergenic
1008646068 6:53516327-53516349 ACACAAAGCCCTCTGAAAAGGGG - Intronic
1009244851 6:61224219-61224241 ACACAGCTCCTTATGAAAATTGG - Intergenic
1009973261 6:70646865-70646887 ACAGGGCTCACTCTCAGAAGAGG + Intergenic
1011422720 6:87190935-87190957 AAACAGCTACCTCTGAAGAGTGG - Intronic
1012234105 6:96792573-96792595 AAAGAGCTCACCCTGAGAAGTGG - Intergenic
1012436833 6:99223896-99223918 AAACAGCTCTCTCTGGGCAGTGG + Intergenic
1012609709 6:101201467-101201489 ACACAGATGCCACTGAGATGTGG - Intergenic
1012818508 6:104055049-104055071 ACACAGCTAGCTCTCAGAAGTGG + Intergenic
1016840605 6:148520578-148520600 AAACAGCTTCATCTGACAAGAGG - Intronic
1018582334 6:165317819-165317841 ACACAGCGGCCTTTGAGAAGGGG + Intergenic
1020097584 7:5377324-5377346 CCACCCCTCCCTCAGAGAAGGGG + Intronic
1022453050 7:30533809-30533831 ACACAGCTCTCCCTGACAGGCGG + Intronic
1024253652 7:47524087-47524109 AACCAGCGCCCTCTGAGAGGCGG + Intronic
1024568497 7:50704797-50704819 ACACAGCTCCCTCTGCCAAGCGG + Intronic
1024954976 7:54908204-54908226 ACAAAACTCCCACTGAGAACTGG + Intergenic
1025212107 7:57025738-57025760 ACACAGCTCCCTCTGAGAAGGGG - Intergenic
1025659847 7:63551090-63551112 ACACAGCTCCCTCTGAGAAGGGG + Intergenic
1028776397 7:94682115-94682137 ACATACCTCCCCCTGAGAAGTGG + Intergenic
1028864437 7:95691567-95691589 CCTCACCTCCCTCTGAGATGTGG + Intergenic
1029675285 7:102064493-102064515 ACACAGCTCCCTCTGAGAAGGGG - Intronic
1030827736 7:114181505-114181527 ATACAGCTTCCTCTGGGAGGCGG + Intronic
1031560673 7:123234281-123234303 ACACAGGTCCATCAGAGAAATGG + Intergenic
1032215110 7:129951943-129951965 ACAGAGCTCTTTCTTAGAAGAGG + Intronic
1032625276 7:133585183-133585205 ACACTGCTTCCTCTTCGAAGAGG - Intronic
1033298743 7:140166166-140166188 ACATATCTCCCTCAGATAAGCGG + Intronic
1034295583 7:149969252-149969274 ACACAGCTCTTTCTGAGGATGGG - Intergenic
1035649745 8:1255695-1255717 ACACAGCTCCCAGGCAGAAGAGG - Intergenic
1036496171 8:9271877-9271899 ATACGTCCCCCTCTGAGAAGGGG - Intergenic
1036773980 8:11597491-11597513 AAACAGCCCACTCTGGGAAGGGG - Intergenic
1037689732 8:21171905-21171927 ACCCACCTCCCTCTGTGCAGCGG + Intergenic
1038652104 8:29414109-29414131 ACATATCTCCCTCAGATAAGGGG + Intergenic
1039058744 8:33556911-33556933 GAAGAGCTCCCTCTAAGAAGGGG - Intronic
1039551321 8:38445165-38445187 ACAAAGCTCCCTCTGATGTGAGG + Intronic
1040548101 8:48417515-48417537 ACACACCTCCCTCTGGAGAGTGG - Intergenic
1040846603 8:51849110-51849132 ACATAGCTGCTTCTGAGAAAGGG + Intronic
1041087699 8:54271896-54271918 ACAAAGCTCCCTTTGAGATCAGG + Intergenic
1044337516 8:91004703-91004725 ACATGCATCCCTCTGAGAAGAGG + Intronic
1046130283 8:109959179-109959201 ACTAAGCTTCCTCTCAGAAGAGG + Intergenic
1047480016 8:125272954-125272976 ACCCAGCTCCCTCTTGGGAGGGG - Intronic
1048279203 8:133092536-133092558 CCACAGCTCCCACTGTGCAGAGG + Intronic
1048282622 8:133116380-133116402 ACACAGTTCCCTCTGGTAGGTGG - Intronic
1048460806 8:134620210-134620232 ACCCACCTCTCTCTGAGCAGGGG + Intronic
1050511948 9:6405701-6405723 ACACTCCTCCCACTGAGATGTGG + Intergenic
1051138972 9:13956873-13956895 AATCAGCACCCTCTGAGAAATGG - Intergenic
1052244397 9:26316526-26316548 TCACAGCTCCCTCTAAAAATAGG + Intergenic
1055462107 9:76528902-76528924 CCACACCTCCCTGTGAGCAGAGG + Intergenic
1055842432 9:80520785-80520807 ACACAGCAGCCCCTAAGAAGTGG + Intergenic
1057440452 9:95079161-95079183 CCACAGTGCCCTCTGAGAACGGG - Intronic
1058793246 9:108471988-108472010 ACACAGAGCCCTCTGAGCACAGG + Intergenic
1060023091 9:120149142-120149164 CCACTGCTGCCCCTGAGAAGAGG - Intergenic
1060396147 9:123318382-123318404 ACACAGCTCTGACTGAGACGTGG - Intergenic
1062440660 9:136567863-136567885 ACCCAGCCCCTTCTGAGAGGCGG - Intergenic
1185849267 X:3470098-3470120 GCTCAGCTGGCTCTGAGAAGTGG + Intergenic
1186289920 X:8085956-8085978 TCACAGAAGCCTCTGAGAAGAGG - Intergenic
1187903206 X:24043655-24043677 ACTCAGCTCCCACTTATAAGTGG - Intergenic
1187904448 X:24053204-24053226 ACTCAGCTCCCACTTATAAGTGG - Intergenic
1189069757 X:37850882-37850904 ACACTTCTCCCATTGAGAAGTGG - Intronic
1189408236 X:40744875-40744897 ACAGAGCTAGCTATGAGAAGAGG - Intergenic
1190218881 X:48498095-48498117 AGACAGGTCCCTCAGAGGAGGGG - Intergenic
1190399174 X:50014523-50014545 ACACAGCTCTGTGTGAGAACAGG - Intronic
1191070285 X:56393768-56393790 ACACAGCTCCTTATCAGAAATGG - Intergenic
1194485210 X:94478106-94478128 ACAGAGCTGGCTGTGAGAAGAGG - Intergenic
1195702662 X:107716603-107716625 ACACAGCTCGCTCAGAGACCGGG + Intronic
1200278633 X:154757853-154757875 ACACTCCTCCCACTGAGAGGTGG + Intergenic
1200814392 Y:7516704-7516726 GCTCAGCTGGCTCTGAGAAGTGG - Intergenic
1201223102 Y:11790313-11790335 AAACAGCTTCTTCTGAGATGGGG + Intergenic
1201992348 Y:20041889-20041911 ACACAGCTCCTTCTCAGCATTGG - Intergenic