ID: 1025659848

View in Genome Browser
Species Human (GRCh38)
Location 7:63551093-63551115
Sequence CAGCTCCCTCTGAGAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 3, 1: 0, 2: 6, 3: 48, 4: 790}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659838_1025659848 22 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659840_1025659848 18 Left 1025659840 7:63551052-63551074 CCACTGCATGCCTTGGAGGTGCA No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659834_1025659848 28 Left 1025659834 7:63551042-63551064 CCCAGCCCGTCCACTGCATGCCT No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659837_1025659848 23 Left 1025659837 7:63551047-63551069 CCCGTCCACTGCATGCCTTGGAG No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659844_1025659848 -7 Left 1025659844 7:63551077-63551099 CCAAGGCTTGGTAACACAGCTCC No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659835_1025659848 27 Left 1025659835 7:63551043-63551065 CCAGCCCGTCCACTGCATGCCTT No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790
1025659842_1025659848 8 Left 1025659842 7:63551062-63551084 CCTTGGAGGTGCAAGCCAAGGCT No data
Right 1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG 0: 3
1: 0
2: 6
3: 48
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659848 Original CRISPR CAGCTCCCTCTGAGAAGGGG AGG Intergenic
901030709 1:6305386-6305408 CACCTCCCTCCCAGACGGGGCGG + Intronic
901131668 1:6965488-6965510 CAGCCCCCTCTGAGCCAGGGGGG - Intronic
901271000 1:7952916-7952938 CACCTCCCTCCCAGACGGGGTGG - Intergenic
901469260 1:9444273-9444295 CAGCTCCCTCCGGGCAGGCGCGG - Intergenic
901602786 1:10435052-10435074 CAGCTCCCTCCGCAGAGGGGCGG - Intronic
901727066 1:11250282-11250304 CACCTCCCTCCCAGATGGGGCGG + Intronic
902032091 1:13430531-13430553 CAGCTCCCTCTGGGGAGGTGTGG + Intergenic
902620259 1:17646719-17646741 CAGGCCTCTCTGAGAAGGAGAGG + Intronic
903103403 1:21053348-21053370 CACCTCCCTCCCAGACGGGGTGG - Intronic
903162976 1:21502723-21502745 CACCTCCCTCCCAGACGGGGTGG + Intergenic
903519478 1:23935885-23935907 CACCTCCCTCTCGGACGGGGCGG - Intergenic
903525037 1:23987130-23987152 CACCTCCCTCTCGGACGGGGCGG + Intergenic
903525079 1:23987223-23987245 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
903921379 1:26803520-26803542 CACCTCCCTCCCAGACGGGGCGG + Intergenic
903942860 1:26943533-26943555 CTCCTACCTCTGGGAAGGGGTGG + Intronic
904077348 1:27852947-27852969 CACCTCCCTCCCAGACGGGGTGG - Intergenic
904206018 1:28855673-28855695 CAGCCCCCTCTGGGAATGGAAGG + Intronic
904259573 1:29280570-29280592 CAGCTTCCTCTGGGGAGAGGAGG - Intronic
904532135 1:31176714-31176736 CACCTCCCTCCCAGATGGGGCGG - Intergenic
904857300 1:33509290-33509312 CACCTCCCTCCGGGACGGGGCGG + Intergenic
904857317 1:33509336-33509358 CACCTCCCTCCCAGACGGGGTGG + Intergenic
905192157 1:36243885-36243907 CACCTCCCTCCCAGACGGGGCGG + Intronic
905362558 1:37430720-37430742 CAGCTCCACCTGAAAAGGGCAGG + Intergenic
905459188 1:38111258-38111280 TGGCTGCCTCTTAGAAGGGGAGG + Intergenic
905599144 1:39234654-39234676 CACCTCCCTCCCAGACGGGGTGG + Intronic
906136175 1:43502092-43502114 CACCTCCCTCCCAGACGGGGTGG - Intergenic
906399992 1:45497735-45497757 CACCTCCCTCCCAGACGGGGCGG - Intronic
906741992 1:48192628-48192650 CACCTCCCTCCCAGACGGGGTGG - Intergenic
906761723 1:48383093-48383115 CACCTCCCTCCCAGACGGGGCGG + Intronic
907338457 1:53716109-53716131 CAGCTCCCACAGAGGAGGGGAGG + Intronic
907390256 1:54153421-54153443 CAGCTCCCTCGGAGTGGGGATGG - Exonic
907402582 1:54233692-54233714 CACCTCCCTCCCAGACGGGGCGG - Intronic
907527301 1:55061379-55061401 CAGCTCCCACTGGGAGGTGGAGG + Exonic
908768219 1:67572861-67572883 GAGCAGCCTCTGAGAAGGGCCGG - Intergenic
909536379 1:76741253-76741275 CATCTCCCTTGGGGAAGGGGCGG - Intergenic
910771113 1:90833668-90833690 CAGCTCCCAGTGAGCAGGGGAGG - Intergenic
911486498 1:98512423-98512445 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
911486649 1:98512775-98512797 CACCTCCCTCCCAGACGGGGCGG + Intergenic
912298281 1:108489439-108489461 CACCTCCCTCCCAGATGGGGCGG + Intergenic
913305995 1:117429867-117429889 CACCTCCCTCCCAGATGGGGCGG + Intronic
914002130 1:143702871-143702893 CACCTCCCTCCCAGACGGGGTGG - Intergenic
914503083 1:148264756-148264778 CAGGTCGCCCTGAGAAGGGGTGG + Intergenic
914908958 1:151769295-151769317 CACCTCCCTCCCAGACGGGGCGG + Intronic
914959759 1:152196068-152196090 CACCTCCCTCTTGGATGGGGTGG + Intergenic
915112825 1:153575324-153575346 CACCTCCCTCCCAGACGGGGCGG - Intergenic
915301016 1:154951708-154951730 CAGTTTCCTCAGAGAAAGGGAGG - Intronic
915309949 1:155001841-155001863 CGGCTCCCTCCGAGAGGGGGTGG + Intergenic
915607087 1:156959228-156959250 CAGCTCCCTATGACACTGGGAGG + Intronic
916015980 1:160750287-160750309 CAGCACCTTCAGAGAATGGGTGG - Exonic
916037867 1:160936783-160936805 CACCTCCCTCCCAGAGGGGGCGG + Intergenic
916075294 1:161197093-161197115 CAGCTGGTTCTAAGAAGGGGAGG + Intronic
916080585 1:161229534-161229556 AAGCTCCTTCTGGGAATGGGTGG - Exonic
916131629 1:161616593-161616615 CATCTCCCTCCCAGATGGGGTGG + Intronic
916660725 1:166920669-166920691 CAGTCCCCTCGGAGGAGGGGAGG + Intronic
917304631 1:173613438-173613460 CACCTCCCTCCCAGAGGGGGCGG - Intronic
917375567 1:174349066-174349088 CACCTCCCTCCAAGACGGGGCGG + Intronic
917375862 1:174349743-174349765 CACCTCCCTCCCAGACGGGGCGG + Intronic
917583113 1:176396742-176396764 CACCTCCCTCCCAGACGGGGCGG + Intergenic
919806317 1:201382877-201382899 CAGCTCCCTGGGGGAAGGGGAGG - Intronic
919974680 1:202602902-202602924 CAGCTCCCTCAGAGATGTGTGGG - Intronic
920264619 1:204712446-204712468 CACCTCCCTGGGTGAAGGGGAGG - Intergenic
921142681 1:212321376-212321398 CACCTCCCTCCCAGACGGGGTGG + Intronic
921198107 1:212779210-212779232 CACCTCCCTCCCAGACGGGGCGG - Intronic
921198132 1:212779263-212779285 CACCTCCCTCCGAGACGGGGCGG - Intronic
921198176 1:212779359-212779381 CACCTCCCTCTGAGATGGGGCGG - Intronic
921638437 1:217524087-217524109 CACCTCCCTCCCAGACGGGGTGG + Intronic
922102718 1:222488374-222488396 CACCTCCCTCCCAGACGGGGCGG - Intergenic
922712185 1:227842560-227842582 AAGTTCCCTCAGAGAAGGAGAGG - Intronic
923457166 1:234174497-234174519 CAGCTCTCTCAGAGACAGGGCGG - Intronic
923896233 1:238273126-238273148 CAGCTCTCACAGAGAAGAGGGGG - Intergenic
924766031 1:247032458-247032480 CACCTCCCTCCCAGAAGGGGTGG - Intergenic
1063520135 10:6734018-6734040 AAGCTCCGTCTGTGAAGGCGAGG + Intergenic
1063776670 10:9273159-9273181 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
1063776692 10:9273205-9273227 CACCTCCCTCTGCGACGGGGCGG + Intergenic
1063776758 10:9273358-9273380 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
1063776782 10:9273404-9273426 CACCTCCCTCCGGGACGGGGCGG + Intergenic
1064070694 10:12226363-12226385 CACCTCCCTCCCAGATGGGGCGG + Intronic
1064109090 10:12522973-12522995 CATCTCCCTCCCAGATGGGGTGG + Intronic
1065738086 10:28772023-28772045 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1066115228 10:32233537-32233559 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
1066123597 10:32316634-32316656 TAGTTCCCTCTGGGAAGTGGAGG + Intronic
1067119970 10:43465152-43465174 CACCTCCCTCCCGGAAGGGGCGG + Intronic
1067339853 10:45392062-45392084 CACCTCCCTCTCGGACGGGGCGG - Intronic
1067535249 10:47104735-47104757 CACATCCCTCTGAGAAGGGGAGG + Intergenic
1068005951 10:51392869-51392891 CACCTCCCTCCCAGACGGGGCGG + Intronic
1068536355 10:58244351-58244373 CCGCCCCCTCTGGGAAGTGGGGG + Intronic
1069052592 10:63811411-63811433 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1069645406 10:69992970-69992992 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1069698919 10:70407740-70407762 CACCTCCCTCCCAGACGGGGCGG + Intronic
1069733020 10:70631353-70631375 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1069741296 10:70687697-70687719 CACCTCCCTCCCAGACGGGGCGG + Intronic
1069928989 10:71869748-71869770 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1069929992 10:71875786-71875808 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1069930016 10:71875835-71875857 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1070135530 10:73689963-73689985 CACCTCCCTCCCAGACGGGGCGG - Intronic
1070138352 10:73715610-73715632 CACCTCCCTCCTGGAAGGGGCGG + Intergenic
1070788160 10:79174278-79174300 CAGCTCCCACTGGGAGGGGCAGG + Intronic
1070966474 10:80534196-80534218 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1072013350 10:91323226-91323248 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1072117174 10:92376479-92376501 CACCTCCCTCCGGGACGGGGCGG - Intergenic
1072149689 10:92674700-92674722 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1072149912 10:92675199-92675221 CATCTCCCTCCCAGACGGGGTGG + Intergenic
1073000066 10:100278138-100278160 CACCTCCCTCCCAGACGGGGTGG - Intronic
1073238221 10:102036094-102036116 CACCTCCCTCCCAGACGGGGTGG - Intronic
1073386106 10:103129004-103129026 CACCTCCCTCCCAGATGGGGCGG - Intronic
1074152030 10:110767174-110767196 CACCTCCCTCCCAGACGGGGCGG + Intronic
1075050852 10:119182046-119182068 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
1075128867 10:119722284-119722306 CACCTCCCTCCCGGAAGGGGCGG - Intergenic
1075137142 10:119795139-119795161 CACCTCCCTCCCAGACGGGGCGG + Intronic
1075738336 10:124677892-124677914 GAACTCCCTCTGACAAGGGGGGG + Intronic
1075842793 10:125518536-125518558 CACCTCCCTCCTGGAAGGGGTGG - Intergenic
1076188045 10:128464142-128464164 CAGCTCCCTCTGACAGGGGAAGG - Intergenic
1076262661 10:129079932-129079954 CAGAGCCCGCTGAGAAGGAGGGG + Intergenic
1076833451 10:133008332-133008354 CACCTCCCTCGGTGACGGGGAGG + Intergenic
1077014030 11:392185-392207 CAGCCCTCTCTGCCAAGGGGAGG + Intergenic
1077685059 11:4283376-4283398 CACCTCCCTCCCAGGAGGGGCGG - Intergenic
1077690129 11:4334554-4334576 CACCTCCCTCCCAGGAGGGGCGG + Intergenic
1077978547 11:7275328-7275350 CAGCAGCCTCAGAGAAGTGGTGG - Intronic
1078836564 11:15035545-15035567 CCGCTCCCACTCAGAAGGGGTGG + Intronic
1078870423 11:15339129-15339151 CAGCTCACTCTTAGAAGGAGCGG + Intergenic
1079323862 11:19475069-19475091 CAGCAGCCACAGAGAAGGGGAGG + Intronic
1079371991 11:19860179-19860201 CACCTCCCTCCCAGACGGGGTGG + Intronic
1079519428 11:21308366-21308388 CCACTCCCTCTGAGAAGGCTGGG + Intronic
1080036532 11:27718431-27718453 CAGCACCATCTGGGAAGGGTGGG + Intronic
1080098172 11:28430703-28430725 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1080860348 11:36145360-36145382 CACCTCCCTCCCAGACGGGGCGG - Intronic
1081288937 11:41304551-41304573 CACCTCCCTCCCAGACGGGGCGG - Intronic
1081288961 11:41304600-41304622 CACCTCCCTCCCAGACGGGGCGG - Intronic
1081289029 11:41304747-41304769 CACCTCCCTCCCAGACGGGGCGG - Intronic
1081950211 11:47038163-47038185 CACCTCCCTCCCAGACGGGGCGG + Intronic
1082245049 11:49911774-49911796 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1083079145 11:60073109-60073131 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1083174639 11:60941968-60941990 CGGCTTCCTCTGAGAAGAGGAGG - Intronic
1083208233 11:61166397-61166419 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1083420752 11:62551709-62551731 CAGCTCCCTCTGAATGGTGGTGG - Intronic
1083865667 11:65451650-65451672 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1083933858 11:65860362-65860384 CAGCGCCCCCTGTGACGGGGAGG - Intronic
1084049026 11:66588048-66588070 CACCTCCCTCCCAGATGGGGTGG - Intergenic
1084582483 11:70032565-70032587 CAGAACCCACTGTGAAGGGGTGG + Intergenic
1084745495 11:71167425-71167447 CACCTCCCTCCCAGACGGGGCGG + Intronic
1084898422 11:72292638-72292660 CTGCTCAGTCTGAGTAGGGGAGG + Exonic
1084924566 11:72502152-72502174 CACCTCCCTCCGGGACGGGGCGG + Intergenic
1085097824 11:73775228-73775250 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1085139659 11:74129184-74129206 CACCTCCCTCCGGGACGGGGTGG + Intronic
1085360091 11:75877968-75877990 CACCTCCCTCCCAGACGGGGCGG + Intronic
1085463689 11:76710239-76710261 CATCTGCCTCTGAGGAGGGAAGG - Intergenic
1085563199 11:77490260-77490282 CACCTCCCTCTGAGACGGGGCGG - Intergenic
1085563275 11:77490435-77490457 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1086017271 11:82182170-82182192 CACCTCCCTCCCAGATGGGGTGG - Intergenic
1086122410 11:83316520-83316542 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1086366192 11:86111005-86111027 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1088658895 11:112027002-112027024 CACCTCCCTCCCAGACGGGGCGG + Intronic
1089264741 11:117251263-117251285 CACCTCCCTCCGGGACGGGGCGG + Intronic
1089420858 11:118331325-118331347 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1089771677 11:120807587-120807609 GAGCTGCCTCTGAGAAGTGAGGG + Intronic
1089969670 11:122682702-122682724 CAGCTCCCTCTTGGAGGGGAGGG - Intronic
1090181576 11:124704636-124704658 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1090323359 11:125864022-125864044 CACCTCCCTCCCGGAAGGGGCGG - Intergenic
1090410810 11:126508441-126508463 CAGGTCCATCTGAGGAGGAGGGG + Intronic
1090791040 11:130091603-130091625 CATCTCCCTCCCAGACGGGGTGG + Intronic
1092296533 12:7203535-7203557 CAGCTACCTATGATAAGGTGAGG + Exonic
1092331287 12:7589865-7589887 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1092401791 12:8184197-8184219 CACCTCCCTCCCAGATGGGGCGG - Intronic
1092978752 12:13772189-13772211 CAGCTCCCTCTGGGGAGGTTTGG + Intronic
1094103323 12:26785279-26785301 CACCTCCCTCTCGGACGGGGCGG - Intronic
1094716920 12:33022807-33022829 CACCTCCCTCCCAGATGGGGTGG + Intergenic
1096167562 12:49437017-49437039 CACCTCCCTCCCAGACGGGGTGG + Intronic
1096245672 12:49984215-49984237 CAGCTCCCTGGGAGGAAGGGAGG + Intronic
1096386905 12:51200109-51200131 CAGCTAGATGTGAGAAGGGGTGG - Intronic
1097110059 12:56651770-56651792 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1097149210 12:56963878-56963900 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1097181654 12:57175206-57175228 GTGCTCCCTGTGGGAAGGGGAGG + Intronic
1098412796 12:70202367-70202389 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1100364864 12:93910832-93910854 CAGCTCCTTCTGAGAAAGGTGGG - Intergenic
1100582419 12:95948338-95948360 CACCTCCCTCCCAGACGGGGCGG - Intronic
1100994945 12:100294168-100294190 CACCTCCCTCCCGGAAGGGGTGG + Intronic
1101183828 12:102251229-102251251 CACCTCCCTCTTGGACGGGGTGG + Intergenic
1101237356 12:102803086-102803108 CAGATCCTTCTGGCAAGGGGTGG + Intergenic
1101357425 12:103993467-103993489 CAGCTCCCTGGGAGGAGGGGTGG - Exonic
1101393432 12:104323590-104323612 CACCTCCCTCCCAGACGGGGCGG + Intronic
1102057344 12:109906558-109906580 CAGCTCCATCTGAGGATGGAAGG - Exonic
1102174878 12:110867586-110867608 CACCTCCCTCCCAGACGGGGCGG + Intronic
1102186259 12:110950829-110950851 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1102186335 12:110951005-110951027 CACCTCCCTCCCGGAAGGGGTGG + Intergenic
1102293968 12:111723331-111723353 CACCTCCCTCCCAGACGGGGCGG + Intronic
1102526995 12:113519615-113519637 TTGCTCCCTCCGAGCAGGGGCGG + Intergenic
1103457384 12:121076930-121076952 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1103457408 12:121076979-121077001 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1103903570 12:124315845-124315867 GAGCTCCCTCTGTGGAGGTGAGG + Exonic
1104712563 12:130996668-130996690 CACCTCCCTCCCAGACGGGGCGG + Intronic
1104775040 12:131385932-131385954 AAGCTCCCTCGGGGAGGGGGCGG - Intergenic
1104843336 12:131834826-131834848 CAGGTCCATCTGGGAGGGGGCGG - Intronic
1105248518 13:18674061-18674083 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1105367847 13:19779534-19779556 CACCTCCCTCCGGGACGGGGCGG - Intronic
1106113228 13:26795119-26795141 GAGCCCCCTCAGAGATGGGGAGG + Intergenic
1106559986 13:30839309-30839331 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1106560041 13:30839436-30839458 CACCTCCCTCCGGGACGGGGCGG + Intergenic
1106746838 13:32716548-32716570 CACCTCCCTCCCAGATGGGGTGG - Intronic
1107498865 13:40955255-40955277 CACCTCCCTCCCAGACGGGGTGG - Intronic
1107562738 13:41572201-41572223 CACCTCCCTCCCAGACGGGGCGG - Intronic
1108330277 13:49378291-49378313 CACCTCCCTCCCAGATGGGGCGG - Intronic
1108351371 13:49593078-49593100 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1108608834 13:52064476-52064498 CACCTCCCTCCCAGACGGGGCGG - Intronic
1113404404 13:110024421-110024443 CTGCTTCCTCTGAGAGGGGACGG - Intergenic
1113862815 13:113500906-113500928 CAGTGCCCTCCAAGAAGGGGTGG + Intronic
1114507994 14:23232668-23232690 CACCTCCCTCCCAGACGGGGCGG - Intronic
1114508040 14:23232763-23232785 CACCTCCCTCCCAGACGGGGCGG - Intronic
1115271686 14:31560161-31560183 CACCTCCCTCCGGGACGGGGCGG + Intronic
1115688861 14:35824593-35824615 AACCTCCCTCCCAGAAGGGGCGG + Intergenic
1115688884 14:35824642-35824664 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
1115847492 14:37555330-37555352 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1115847540 14:37555428-37555450 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1116005219 14:39285387-39285409 CACCTCCCTCCCGGAAGGGGCGG + Intronic
1116191855 14:41674339-41674361 CACCTCCCTCCCAGATGGGGCGG + Intronic
1117277186 14:54203728-54203750 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1117596867 14:57333781-57333803 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1118428410 14:65692241-65692263 CACCTCCCTCCCAGATGGGGCGG + Intronic
1118428511 14:65692466-65692488 CACCTCCCTCCCAGACGGGGCGG + Intronic
1119254247 14:73184064-73184086 CACCTCCCTCCCAGACGGGGCGG + Intronic
1119254413 14:73184401-73184423 CACCTCCCTCTCCGACGGGGCGG + Intronic
1119835768 14:77747730-77747752 CACCTCCCTCCCAGACGGGGCGG - Intronic
1120309858 14:82814436-82814458 CACCTCCCTCCGGGACGGGGTGG + Intergenic
1120406508 14:84099468-84099490 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1122093696 14:99356190-99356212 CAGCTGCTTCTGAGCAGGGCGGG + Intergenic
1202848125 14_GL000009v2_random:200163-200185 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1123666151 15:22610680-22610702 CAGCAGCCTCTGGGGAGGGGAGG - Intergenic
1124132553 15:27003864-27003886 CACCTCCCTCCCAGACGGGGCGG + Intronic
1124319974 15:28705086-28705108 CAGCAGCCTCTGGGGAGGGGAGG - Intronic
1124436146 15:29651469-29651491 CAGCCCACTCTGAGAATGGGAGG - Intergenic
1124564043 15:30798832-30798854 CAGCAGCCTCTGGGGAGGGGAGG + Intergenic
1125747602 15:42007807-42007829 CAGCTTCTTCTGAGAGGCGGTGG + Exonic
1125861679 15:43005447-43005469 CACCTCCCTCCCAGATGGGGTGG - Intronic
1125862876 15:43014859-43014881 CACCTCCCTCTGGGACGGGGCGG - Intronic
1126112710 15:45185109-45185131 CAGAACCCTCTGAGAAGGGATGG - Intronic
1126516981 15:49549972-49549994 CACCTCCCTCCCAGACGGGGCGG + Intronic
1127072928 15:55302961-55302983 CACCTCCCTCTTGGACGGGGTGG - Intronic
1127154181 15:56110069-56110091 CACCTCCCTCCCAGACGGGGCGG - Intronic
1127154409 15:56110570-56110592 CACCTCCCTCCCAGACGGGGTGG - Intronic
1127154487 15:56110747-56110769 CACCTCCCTCCCAGACGGGGTGG - Intronic
1127154590 15:56111002-56111024 CACCTCCCTCCCAGACGGGGTGG - Intronic
1127644676 15:60946995-60947017 CACCTCCCTCCCGGAAGGGGCGG - Intronic
1127782873 15:62332263-62332285 CACCTCCCTCCTAGACGGGGCGG + Intergenic
1127924352 15:63524394-63524416 CTGCTCCCTCTGTTAAGTGGTGG + Intronic
1128489757 15:68134679-68134701 CACCTCCCTCCCGGAAGGGGTGG + Intronic
1128489999 15:68135203-68135225 CACCTCCCTCCCGGAAGGGGTGG + Intronic
1128586831 15:68859538-68859560 CACCTCCCTCCCAGATGGGGCGG + Intronic
1128586966 15:68859842-68859864 CACCTCCCTCCGGGACGGGGCGG + Intronic
1128587123 15:68860195-68860217 CACCTCCCTCCGGGACGGGGCGG + Intronic
1128970528 15:72101667-72101689 CACCTCCCTCCCAGACGGGGCGG - Intronic
1129054077 15:72807092-72807114 CACCTCCCTCCTAGACGGGGCGG + Intergenic
1129431732 15:75504618-75504640 CACCTCCCTCCCAGACGGGGCGG - Intronic
1130428278 15:83822137-83822159 CACCTCCCTCCCAGACGGGGCGG + Intronic
1130484782 15:84392666-84392688 CACCAGCCTCTGGGAAGGGGAGG + Intergenic
1130893134 15:88150219-88150241 CTCCTCCCTCTGAGATGGGCAGG - Intronic
1132036971 15:98493035-98493057 CACCTCCCTCCCAGACGGGGTGG + Intronic
1132533206 16:463949-463971 CAGCCCTCTCTGAGGAGGGGTGG + Intronic
1132720678 16:1314158-1314180 CAGCTCCCTCCCAGTAGGGAGGG - Intronic
1133041921 16:3065411-3065433 CTGCTCCCTCTGAGCTGGGGTGG - Exonic
1133054466 16:3138632-3138654 CAGCTCCCTCTGTGAAGTCCAGG + Intronic
1133270878 16:4610290-4610312 CAGCTCCCCCTGAGACCTGGGGG - Intronic
1134854276 16:17505955-17505977 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1135242916 16:20825404-20825426 CTTCTCCCTCTGTGAAGTGGGGG + Intronic
1136258832 16:29060259-29060281 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1136425996 16:30169454-30169476 CACCTCCCTCCGGGACGGGGCGG - Intergenic
1136552585 16:30989500-30989522 CTGTCCCCTCTGAGAAGGGGAGG + Exonic
1136558777 16:31025919-31025941 CAGCTCACAGGGAGAAGGGGAGG + Intergenic
1136619112 16:31416272-31416294 CAGCTCACCCTGAGAAGCTGAGG - Exonic
1136668590 16:31836608-31836630 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1136668614 16:31836657-31836679 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1137522985 16:49210344-49210366 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1137924213 16:52524577-52524599 CAGCCCTCTGTGGGAAGGGGAGG - Intronic
1138043542 16:53698520-53698542 CACCTCCCTCCCAGACGGGGCGG - Intronic
1138043636 16:53698744-53698766 CACCTCCCTCCCAGACGGGGCGG - Intronic
1138467250 16:57201066-57201088 CACCTCCCTCCCAGACGGGGTGG + Intronic
1138642209 16:58396147-58396169 CACCTCCCTCTTGGACGGGGCGG + Intronic
1139589789 16:67927223-67927245 CACCTCTCTCTGGAAAGGGGAGG + Intronic
1139633421 16:68244388-68244410 CAGCTGCCCCTTCGAAGGGGTGG + Intergenic
1140187215 16:72786000-72786022 CAGCTCCCTCTAAGAAATGAAGG + Exonic
1140900469 16:79362376-79362398 GATCTCCCTCTGAAAAGTGGGGG - Intergenic
1140994157 16:80243479-80243501 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1140994250 16:80243708-80243730 CACCTCCCTCCAAGATGGGGCGG - Intergenic
1141246176 16:82309647-82309669 CAGCTTCCCTTGAGTAGGGGAGG + Intergenic
1141536340 16:84683350-84683372 CAGCCTCCTGGGAGAAGGGGAGG - Intergenic
1141664673 16:85459840-85459862 CAACCCCCTCTGTGAAGGAGGGG - Intergenic
1141896000 16:86959191-86959213 CTATTCCCTCTGAGCAGGGGAGG + Intergenic
1142011821 16:87719074-87719096 CACCTCCCTCCCAGACGGGGCGG - Intronic
1142164271 16:88577402-88577424 CAGCTCCCCCTGCGAGGAGGAGG + Exonic
1142215622 16:88828469-88828491 CAGTTCCCTCTGGGCAGGGGAGG - Intronic
1142740027 17:1926463-1926485 CAGCTCCCTCAGTGACCGGGTGG + Intergenic
1143564358 17:7712436-7712458 CAGGGCCCACTGAGAAAGGGAGG + Intergenic
1143884833 17:10057607-10057629 CACCTCCCTCCCAGACGGGGCGG - Intronic
1143919454 17:10319224-10319246 CAGCCCCCTTTGAGAGGGGCTGG + Intronic
1145058084 17:19716191-19716213 CAGCCCCCACACAGAAGGGGTGG - Intronic
1145087094 17:19951162-19951184 CACCTCCCTCCCAGATGGGGCGG - Intronic
1145205839 17:20984617-20984639 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1145750872 17:27354127-27354149 CAGCCCACCCTGAGAAGTGGGGG + Intergenic
1145862999 17:28224307-28224329 CACCTCCCTCCCGGAAGGGGCGG - Intergenic
1145920129 17:28604142-28604164 CACCTCCCTCCTGGAAGGGGCGG + Intronic
1145941786 17:28746622-28746644 CACCTGCCTCTGAGAAGGGGTGG - Intronic
1146444223 17:32922392-32922414 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1147661554 17:42119710-42119732 CAGCACACCCTGAGAAGGGGTGG + Exonic
1147809646 17:43159328-43159350 CACCTCCCTCCGGGACGGGGCGG + Intergenic
1147820744 17:43240340-43240362 GAGCGCCCTCTGTGAAAGGGCGG - Intergenic
1147826217 17:43271788-43271810 CACCGCCCTCTGTGAAAGGGCGG - Intergenic
1147905271 17:43818452-43818474 CAGCTCCCTCAGAGATGGGGAGG - Intronic
1147974482 17:44238893-44238915 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1148208371 17:45793586-45793608 CAGCTCCCTGTGAGTCGGTGTGG + Intronic
1148323423 17:46770700-46770722 CAACTCCCTCCCAGAAGGGTAGG + Intronic
1148328231 17:46796517-46796539 CAACTCCTTCTGAGAGGGGCAGG - Intronic
1148632852 17:49125681-49125703 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1148632874 17:49125727-49125749 CACCTCCCTCCGGGACGGGGCGG - Intergenic
1148636082 17:49150274-49150296 CACCTCCCTCCCAGACGGGGCGG - Intronic
1149633059 17:58142683-58142705 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1150477960 17:65488520-65488542 CCCCTCCCTCTGTGTAGGGGGGG - Intergenic
1151768570 17:76145071-76145093 CAGTTCCCTCTGAGAGGTGAGGG + Exonic
1152034567 17:77864137-77864159 CAGCTGCCTCTGTGAAAGTGAGG - Intergenic
1152229526 17:79107471-79107493 CAGCTCGCTGTGAGAAGGCAGGG + Intronic
1152568781 17:81112171-81112193 CAGGTCCCTCTGAGCTGAGGGGG + Intronic
1152696098 17:81797786-81797808 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1152809987 17:82376819-82376841 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1153605360 18:6827376-6827398 CACCTCCCTCCGAGATGGGGCGG + Intronic
1153605457 18:6827599-6827621 CACCTCCCTCCGAGACGGGGCGG + Intronic
1154398146 18:14010597-14010619 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1154423307 18:14252959-14252981 CTGTTTCCTCTGAGTAGGGGAGG - Intergenic
1154990128 18:21592389-21592411 CACCTCCCTCCCAGATGGGGCGG + Intronic
1156326253 18:36077625-36077647 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1157053558 18:44198375-44198397 CATCTCCCTCTGAGAAGCTCTGG + Intergenic
1157455902 18:47828207-47828229 CACCTCCCTCCCAGACGGGGCGG - Exonic
1157640002 18:49203205-49203227 CACCTCCCTCCCAGACGGGGTGG - Intronic
1157677288 18:49577855-49577877 CATCTCCCTCCCAGACGGGGTGG + Intronic
1157705257 18:49800154-49800176 CACCTCCCTCCCAGACGGGGTGG - Intronic
1158591852 18:58784915-58784937 CCGCCACCTCTGAGAAGGGCAGG + Intergenic
1160518936 18:79493607-79493629 CAGCTCCGGCTCAGGAGGGGCGG - Intronic
1160531463 18:79567493-79567515 CAGCACCCCCTGACCAGGGGCGG - Intergenic
1160916581 19:1499477-1499499 CACCTCCCTCCCAGATGGGGTGG + Intergenic
1161260754 19:3336709-3336731 CAGCTCCCCCTGGGAGGTGGGGG - Intergenic
1161378486 19:3951940-3951962 CAGCCCCCTCTGAGGATGGAGGG - Intergenic
1162231454 19:9270503-9270525 CAGCTCCAGCTCATAAGGGGTGG - Intergenic
1162255202 19:9483607-9483629 CACCTCCCTCCCAGACGGGGCGG - Intronic
1162964314 19:14148837-14148859 CAGCTCCCCGGGAGAAGGGAGGG + Exonic
1163093499 19:15037881-15037903 CAGCTCTCTTTGAGAAGCCGAGG + Intergenic
1163606656 19:18279627-18279649 CTGCTCCCTCCAACAAGGGGAGG + Intergenic
1163945221 19:20529822-20529844 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1164043185 19:21511265-21511287 CACCTCCCTCCCAGATGGGGTGG + Intronic
1164046947 19:21551341-21551363 CACCTCCCTCCCGGAAGGGGTGG + Intronic
1164054058 19:21607155-21607177 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1164081701 19:21865789-21865811 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1164105299 19:22105260-22105282 CACCTCCCTCCCGGAAGGGGCGG - Intergenic
1164168452 19:22702873-22702895 CACCTCCCTCCGGGACGGGGTGG + Intergenic
1164192182 19:22926351-22926373 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1164238930 19:23366206-23366228 CACCTCCCTCCCAGATGGGGCGG + Intronic
1164244719 19:23419503-23419525 CACCTCCCTCCGGGACGGGGCGG - Intergenic
1164263990 19:23595061-23595083 CACCTCCCTCCCAGATGGGGCGG - Intronic
1165438754 19:35812040-35812062 TAGCTCCTTCTGAAATGGGGTGG + Exonic
1165471884 19:36008818-36008840 CAGGTTCCTCTTGGAAGGGGCGG - Intergenic
1165481885 19:36069179-36069201 CACCTCCCTCCGGGACGGGGCGG + Intronic
1166029822 19:40118117-40118139 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1166030098 19:40118746-40118768 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1166162841 19:40965974-40965996 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1166162969 19:40966276-40966298 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1166191840 19:41180812-41180834 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1166261570 19:41644757-41644779 CACCTCCCTCCCAGATGGGGTGG - Intronic
1166418006 19:42610453-42610475 CACCTCCCTCCCAGATGGGGTGG + Intronic
1166730583 19:45057049-45057071 CAGCTGCCTCTGAGGAGCAGTGG + Intronic
1166832726 19:45648245-45648267 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1167575068 19:50314103-50314125 CAGGTCCCTGGGGGAAGGGGCGG + Intronic
1167907803 19:52676526-52676548 CACCTCCCTCCCAGACGGGGCGG - Intronic
1167970862 19:53187338-53187360 CAACTCCCTCCCAGACGGGGCGG + Intronic
1168356207 19:55701567-55701589 CAGCTCCTTCTGAGAACTGCTGG - Intronic
1168696039 19:58405053-58405075 CACCTCCCTCCCAGATGGGGCGG + Intronic
927501058 2:23583548-23583570 CATGTCCCTCTCAGAAGGGAAGG + Intronic
927776861 2:25910356-25910378 CACCTCCCTCCCAGACGGGGCGG + Intergenic
927833056 2:26370498-26370520 CACCTCCCTCCCAGACGGGGCGG + Intronic
927833107 2:26370624-26370646 CACCTCCCTCCCAGACGGGGCGG + Intronic
929447857 2:42014743-42014765 CACCTCCCTCCCAGACGGGGCGG + Intergenic
929577739 2:43063157-43063179 CACCTCCCTCCCAGACGGGGCGG + Intergenic
929650796 2:43677938-43677960 CACCTCCCTCCCAGACGGGGCGG + Intronic
929690099 2:44067034-44067056 CACCTCCCTCCTAGACGGGGCGG + Intergenic
929690149 2:44067162-44067184 CACCTCCCTCCCAGACGGGGCGG + Intergenic
929690173 2:44067212-44067234 CACCTCCCTCCCAGACGGGGCGG + Intergenic
929946272 2:46375010-46375032 CAGCCCCAACTGAGAAAGGGTGG + Intronic
930202046 2:48556580-48556602 CACCTCCCTCCCAGACGGGGCGG + Intronic
930396354 2:50828377-50828399 CACCTCCCTCCCAGACGGGGTGG + Intronic
930665383 2:54095622-54095644 CACCTCCCTCCCAGATGGGGCGG + Intronic
931479988 2:62630520-62630542 CACCTCCCTCCCAGACGGGGCGG - Intergenic
931499904 2:62854868-62854890 CAGCCCCAACTCAGAAGGGGCGG - Intronic
932407960 2:71526431-71526453 CAGCTCCCTGGGGGAAGGAGAGG + Intronic
932710812 2:74061606-74061628 CACCTCCCTCCCAGACGGGGTGG + Intronic
932718983 2:74124148-74124170 CACCTCCCTCCCAGATGGGGCGG - Intergenic
932719050 2:74124289-74124311 CACCTCCCTCCCAGACGGGGTGG - Intergenic
933734963 2:85487831-85487853 CACCTCCCTCCCAGACGGGGTGG - Intergenic
934287259 2:91659331-91659353 CTCCTCCCTCTGTGATGGGGTGG - Intergenic
934309694 2:91851970-91851992 CACCTCCCTCCCAGATGGGGCGG - Intergenic
934998494 2:98988861-98988883 CACCTCCCTCCCAGAAGGGGCGG + Intergenic
935630574 2:105210557-105210579 CACCTCCCTCCCAGATGGGGCGG + Intergenic
936504730 2:113096500-113096522 CACCTCCCTCCCAGACGGGGCGG + Intergenic
936546472 2:113395132-113395154 CACCTCCCTCCCAGACGGGGCGG - Intergenic
936546496 2:113395181-113395203 CACCTCCCTCCCAGACGGGGCGG - Intergenic
937786353 2:125904132-125904154 AACCTCCCTCTGAGAAGTGGTGG + Intergenic
937909920 2:127070510-127070532 GAGGGCCCTCTGAGAAGGGCAGG + Intronic
938006118 2:127788758-127788780 CACCTCCCTCCCAGATGGGGCGG + Intronic
938253421 2:129833673-129833695 CACCTCCCTCCCAGACGGGGCGG - Intergenic
938534125 2:132221895-132221917 CACCTCCCTCCCAGACGGGGCGG - Intronic
938720705 2:134064274-134064296 CACCTCCCTCCCAGATGGGGCGG - Intergenic
938852510 2:135275306-135275328 CACCTCCCTCCCAGATGGGGTGG + Intronic
938852530 2:135275352-135275374 CACCTCCCTCCCAGATGGGGCGG + Intronic
939584722 2:143991665-143991687 CACCTCCCTCCCAGACGGGGCGG - Intronic
939584767 2:143991762-143991784 CACCTCCCTCCCAGACGGGGCGG - Intronic
940652282 2:156451479-156451501 CACCTCCCTCCCGGAAGGGGCGG + Intronic
940652305 2:156451529-156451551 CACCTCCCTCCCAGACGGGGCGG + Intronic
940885503 2:158986323-158986345 CAGCACTCTCTCAGGAGGGGAGG + Intronic
941025172 2:160449227-160449249 CACCTCCCTCCCAGATGGGGCGG - Intronic
941289978 2:163662754-163662776 CAGGTCCCTCTGACAACAGGGGG - Intronic
941603115 2:167563915-167563937 CACCTCCCTCCCAGACGGGGCGG + Intergenic
941768863 2:169327291-169327313 CACCTCCCTCCCAGACGGGGCGG - Intronic
941768934 2:169327464-169327486 CACCTCCCTCCCAGACGGGGCGG - Intronic
941847914 2:170150259-170150281 CACCTCCCTCCCAGACGGGGCGG - Intergenic
942307381 2:174622006-174622028 GCACTCCCTCTGAGAAGGGAGGG - Intronic
942355737 2:175108488-175108510 CACCTCCCTCCCGGAAGGGGCGG - Intronic
942630653 2:177946763-177946785 CACCTCCCTCCCAGACGGGGCGG - Intronic
943297091 2:186153971-186153993 CACCTCCCTCCCAGACGGGGCGG + Intergenic
943297136 2:186154069-186154091 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
943411743 2:187556747-187556769 CACCTCCCTCCCAGACGGGGTGG - Intronic
943411904 2:187557138-187557160 CACCTCCCTCCCAGACGGGGCGG - Intronic
944283380 2:197922914-197922936 CACCTCCCTCCCAGATGGGGCGG + Intronic
944661302 2:201923992-201924014 AATCTCCCTGTGAGAAGGGAGGG + Intergenic
944751556 2:202715264-202715286 CACCTCCCTCCGGGACGGGGCGG + Intronic
945114918 2:206400876-206400898 CACCTCCCTCCCAGACGGGGCGG + Intergenic
945316612 2:208377507-208377529 CACCTCCCTCCCAGACGGGGCGG + Intronic
945316636 2:208377554-208377576 CACCTGCCTCTGGGACGGGGCGG + Intronic
946145681 2:217729265-217729287 GAGCTCCTTCTTAGAAGTGGTGG - Intronic
947332154 2:229041178-229041200 CAGCTCTGTCTGAGTAGGGATGG - Intronic
947402459 2:229743185-229743207 CACCTCCCTCCCAGACGGGGCGG - Intergenic
948707604 2:239804779-239804801 CAGCTCCCTCTGAGACAGTGAGG - Intergenic
948762721 2:240202768-240202790 CAGCTCCCTCTGCAAGGGTGAGG - Intergenic
1169066240 20:2695617-2695639 CAGCTCCCTCTGGGACAGGGAGG - Intronic
1170412323 20:16104898-16104920 CTGCTCCATCAGAGCAGGGGTGG + Intergenic
1170715554 20:18828156-18828178 CCCCTCCCTCTGAGCTGGGGTGG + Intronic
1171029999 20:21668839-21668861 CAGCACCCTTGTAGAAGGGGAGG + Intergenic
1171189113 20:23145855-23145877 CAGCTCTCACAGAGATGGGGGGG + Intergenic
1171442763 20:25178725-25178747 CAGCTCCATGAGAGAAGGGAGGG + Intergenic
1171861281 20:30405111-30405133 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1172051437 20:32121941-32121963 CAGCTCCCTCCCGGACGGGGCGG + Intronic
1172257979 20:33536310-33536332 CACCTCCCTCCCAGACGGGGCGG + Intronic
1172279346 20:33699387-33699409 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1172280021 20:33701672-33701694 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1172349593 20:34230026-34230048 CACCTCCCTCCCAGACGGGGCGG + Intronic
1172720978 20:37000299-37000321 CACCTCCCTCCCAGACGGGGTGG - Intronic
1172819425 20:37718472-37718494 CACCTCCCTCCCAGACGGGGCGG + Intronic
1172918391 20:38461333-38461355 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1173362221 20:42355044-42355066 CACTTGCCTCTGAGAAGGAGTGG - Intronic
1173616867 20:44408951-44408973 CAGGGCCCACTGAGAAGGAGGGG + Intronic
1174020567 20:47525773-47525795 CACCTCCCTCCCAGACGGGGCGG + Intronic
1174835837 20:53854577-53854599 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1176117437 20:63439211-63439233 CACCTCCCTCTGAGCTGGGTGGG + Intronic
1176348337 21:5770771-5770793 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1176355151 21:5891355-5891377 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1176496490 21:7553684-7553706 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1176542658 21:8168841-8168863 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1176561609 21:8351886-8351908 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1177178261 21:17720048-17720070 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1178075562 21:29011566-29011588 CACCTCCCTCCCGGAAGGGGCGG - Intronic
1179611679 21:42556029-42556051 CAGCTCTGTCTGAAAAGGAGTGG - Intronic
1179646339 21:42778531-42778553 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1179646362 21:42778579-42778601 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1179969350 21:44825290-44825312 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1180039597 21:45269015-45269037 CACCTCCCTCCCAGACGGGGCGG - Intronic
1180039648 21:45269142-45269164 CACCTCCCTCCCAGACGGGGCGG - Intronic
1181273943 22:21676992-21677014 CACCTCCCTCTTGGACGGGGCGG + Intronic
1181538673 22:23561264-23561286 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1181586229 22:23854885-23854907 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1181982107 22:26773216-26773238 CATCTCCCTCCCAGACGGGGTGG + Intergenic
1182616275 22:31591916-31591938 CACCTCCCTCCCAGACGGGGCGG + Intronic
1183449083 22:37881134-37881156 TAGCTTCCTCTCAGGAGGGGAGG + Intronic
1183650509 22:39150997-39151019 CAGCTCCCTGAGGGAAGGGGTGG + Intronic
1183941003 22:41294956-41294978 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1184145518 22:42607915-42607937 CACCTCCCTCCCAGACGGGGCGG - Intronic
1184219492 22:43090230-43090252 CTGCTGCCTCTCAGGAGGGGTGG + Intergenic
1184239390 22:43203925-43203947 CAGCTCCCACTGTGGAGGGCAGG + Exonic
1184594392 22:45505004-45505026 CAGCTCTCTGAGAGCAGGGGCGG - Intronic
1203247523 22_KI270733v1_random:85084-85106 CACCTCCCTCCCAGACGGGGCGG + Intergenic
949569984 3:5283912-5283934 CACCTCCCTCCCAGACGGGGTGG + Intergenic
950251948 3:11473127-11473149 CAGCTCCCTCTTATATGGTGAGG + Intronic
950253724 3:11487751-11487773 CAGCTCCCTCCCGGACGGGGTGG + Intronic
950335311 3:12188470-12188492 CACCTCACTCTGAGAAGCAGGGG - Intronic
950412691 3:12849667-12849689 CACCTCCCTCCCAGACGGGGTGG + Intronic
950469255 3:13174469-13174491 GAGCCCCCGCTGAGATGGGGAGG - Intergenic
950754689 3:15162801-15162823 CACCTCCCTCCCAGATGGGGCGG + Intergenic
950949144 3:16980283-16980305 CACCTCCCTCTTGGACGGGGCGG + Intronic
950969281 3:17170271-17170293 CAGCTCCCACTGGGTAGGTGGGG + Intronic
951115914 3:18861588-18861610 TATCTCTCTCTGATAAGGGGGGG - Intergenic
951550507 3:23871521-23871543 CACCTCCCTCTCGGACGGGGTGG + Intronic
952252263 3:31666118-31666140 AAGCTTGCTCTGAGGAGGGGAGG + Intronic
952934873 3:38389539-38389561 CACCTCCCTCCCAGACGGGGCGG + Intronic
953686360 3:45081342-45081364 CCTCTCCCACTGAGATGGGGTGG + Intergenic
953778613 3:45844903-45844925 CAACTCCCTCTAAGAATGTGTGG + Intronic
953855152 3:46494810-46494832 CACCTCCCTCCCAGACGGGGCGG - Intergenic
953855205 3:46494938-46494960 CACCTCCCTCCCAGACGGGGCGG - Intergenic
953959528 3:47256497-47256519 CACCTCCCTCCCAGACGGGGCGG - Intronic
954162816 3:48734489-48734511 CACCTCCCTCCCAGACGGGGCGG - Intronic
954162916 3:48734714-48734736 CACCTCCCTCCCAGATGGGGCGG - Intronic
954481240 3:50803708-50803730 CACCTCCCTCCCAGATGGGGCGG + Intronic
954718405 3:52538856-52538878 CATCTGGCTCTGTGAAGGGGAGG + Intronic
954957466 3:54534425-54534447 CAGCTCCGAGTGAGCAGGGGAGG - Intronic
955297611 3:57748062-57748084 CACCTCCCTCCCAGACGGGGCGG - Intergenic
955763867 3:62319216-62319238 CAGATGACTCTGAGAAGGTGCGG + Exonic
956270520 3:67444313-67444335 CACCTCCCTCCCAGACGGGGCGG - Intronic
956270670 3:67444666-67444688 CACCTCCCTCCCAGACGGGGCGG - Intronic
956412773 3:68995560-68995582 CAGCAGCCACAGAGAAGGGGAGG + Intronic
956845393 3:73177703-73177725 CAGGTGCCTCTGAGAACTGGAGG - Intergenic
956915414 3:73865965-73865987 CAGAGCCCTCTGAGAAAGGATGG - Intergenic
957620204 3:82584814-82584836 CACCTCCCTCCCAGATGGGGCGG - Intergenic
958795458 3:98702301-98702323 CATCTGCCTCTGAGAAAGGCAGG + Intergenic
958808422 3:98837109-98837131 CACCTCCCTCCCAGACGGGGTGG + Intronic
959415313 3:106073974-106073996 CACCTCCCTCCCAGACGGGGCGG + Intergenic
959415410 3:106074197-106074219 CACCTCCCTCCCAGACGGGGCGG + Intergenic
960029912 3:113046282-113046304 CAACTCCCTCCCAGACGGGGCGG + Intergenic
960921027 3:122747514-122747536 CACCTCCCTCCGAGACGGGGCGG - Intronic
960921070 3:122747609-122747631 CACCTCCCTCCCAGATGGGGCGG - Intronic
960921121 3:122747736-122747758 CACCTCCCTCCGGGACGGGGCGG - Intronic
961163818 3:124750399-124750421 CACCTCCCTCCCAGACGGGGCGG + Intergenic
961962417 3:130868098-130868120 CACCTCCCTCCGGGACGGGGTGG - Intronic
962357294 3:134705666-134705688 CAGCTCCCCATAAGAAGGGTTGG - Intronic
962748182 3:138413132-138413154 CAGCTCCATCTGAGAAGTCGAGG + Intergenic
963549665 3:146703269-146703291 CATCTCCCTCTGAGAAGTTCTGG - Intergenic
963770107 3:149380160-149380182 CACCTCCCTCCGAGACGGGGCGG - Intergenic
966015116 3:175131880-175131902 CACCTCCCTCCCAGACGGGGCGG + Intronic
966015394 3:175132571-175132593 CACCTCCCTCCCAGACGGGGCGG + Intronic
966200102 3:177353208-177353230 CAGCCCTCTCTGAGAAGGTGAGG + Intergenic
966420111 3:179727984-179728006 CACCTCCCTCCCAGACGGGGCGG + Intronic
967169359 3:186811641-186811663 CACCTCCCTCCCAGACGGGGCGG + Intergenic
967177491 3:186873989-186874011 CACCTCCCTCCCAGATGGGGTGG - Intergenic
967971984 3:195005997-195006019 AGGCTTCCTCTGAGATGGGGTGG - Intergenic
968025835 3:195442363-195442385 AAGCTCCCTCAAAGAGGGGGTGG + Intronic
968284838 3:197502417-197502439 CTGATGTCTCTGAGAAGGGGAGG + Intergenic
968973684 4:3810248-3810270 CAGCTCCCCCTGTGTAGGGAGGG + Intergenic
969122967 4:4923343-4923365 CAGCACCCTATGAGATGGGCAGG - Intergenic
969404202 4:6978048-6978070 CACCTCCCTCCCAGACGGGGTGG - Intronic
969447507 4:7253587-7253609 CAGCTCCCTCCCAGATGAGGTGG + Intronic
969501894 4:7558543-7558565 CAGCTCCCTCTGTGCTGGTGCGG + Intronic
971965999 4:33557046-33557068 CAGCTCCCACTGAGAACATGCGG + Intergenic
972552609 4:40147643-40147665 CACCTCCCTCCCAGACGGGGCGG + Intronic
972552631 4:40147690-40147712 CACCTCCCTCCCAGACGGGGCGG + Intronic
972938441 4:44167957-44167979 CACCTCCCTCCCAGAGGGGGTGG - Intergenic
972939802 4:44182147-44182169 CACCTCCCTCTCGGACGGGGCGG - Intronic
973672932 4:53238014-53238036 CACCTCCCTCCAAGATGGGGTGG + Intronic
973675172 4:53255979-53256001 CACCTCCCTCCCAGACGGGGCGG + Intronic
975685782 4:76917330-76917352 CACCTCCCTCCCAGACGGGGCGG - Intergenic
975848420 4:78548233-78548255 CACCTCCCTCCGGGACGGGGTGG - Intergenic
975848494 4:78548406-78548428 CACCTCCCTCCCAGATGGGGCGG - Intergenic
976006727 4:80439457-80439479 CAGCTTCCCTTGACAAGGGGAGG - Intronic
976265750 4:83185638-83185660 CACCTCCCTCCCAGATGGGGCGG + Intergenic
976405235 4:84655317-84655339 CAGCTATGTCTGAGTAGGGGTGG - Intergenic
976675602 4:87698332-87698354 CTGCTCCAACTCAGAAGGGGCGG + Intergenic
977761243 4:100739329-100739351 TAGCTCCTTGTGAGCAGGGGTGG + Intronic
978146600 4:105380645-105380667 AAGTTACCTCTGAGAAGGGAGGG - Intronic
978879249 4:113680916-113680938 CATCTCCCTGTGAGAAAGGTGGG + Intronic
980056412 4:128083583-128083605 CACCTCCCTCCCAGACGGGGCGG + Intronic
980614212 4:135196634-135196656 CAAATTCCTTTGAGAAGGGGTGG + Intergenic
982022170 4:151214646-151214668 CACCTCCCTCCCGGAAGGGGCGG + Intronic
982026130 4:151255135-151255157 CACCTCCCTCCCAGACGGGGTGG + Intronic
982182813 4:152765261-152765283 CACCTCCCTCCCAGACGGGGCGG + Intronic
982182835 4:152765307-152765329 CACCTCCCTCCCGGAAGGGGCGG + Intronic
982292864 4:153796417-153796439 CAGCACCACCTGAGAACGGGAGG - Intergenic
983190306 4:164747390-164747412 CACCTCCCTCCAAGACGGGGCGG + Intergenic
984037938 4:174692294-174692316 CACCTCCCTCCCAGACGGGGCGG - Intronic
984533452 4:180944835-180944857 CACCTCCCTCCCAGACGGGGCGG - Intergenic
984873024 4:184344033-184344055 CAGCTCCTACAGAGAAGGGCAGG + Intergenic
984977202 4:185240706-185240728 CACCTCCCTCCCAGACGGGGTGG + Intronic
986442664 5:7795469-7795491 CAGCCCCCTCTCAGCAGGGTGGG + Intronic
987547851 5:19337391-19337413 AAGCACCCTCTCAGAAGGGATGG - Intergenic
988240077 5:28597054-28597076 CACCTCCCTCCCAGACGGGGCGG + Intergenic
989061469 5:37415470-37415492 CACCTCCCTCCCGGAAGGGGCGG + Intronic
989076004 5:37563714-37563736 CACCTCCCTCCCAGACGGGGTGG + Intronic
989176047 5:38527608-38527630 CTGGTCCCTCAGTGAAGGGGTGG - Intronic
989379742 5:40800623-40800645 CACCTCCCTCCCAGACGGGGCGG - Intergenic
989575086 5:42980729-42980751 CACCTCCCTCTCGGACGGGGCGG - Intergenic
989634873 5:43522308-43522330 CACCTCCCTCCCAGACGGGGTGG - Intergenic
989828935 5:45890881-45890903 CACTTCCCTCTGGGATGGGGAGG - Intergenic
989828977 5:45890973-45890995 CACCTCCCTCTGGGATGGGGAGG - Intergenic
990426917 5:55696534-55696556 CACCTCCCTCCCAGACGGGGCGG + Intronic
991073568 5:62513224-62513246 CATCTCCCTCCCAGACGGGGCGG + Intronic
991073614 5:62513322-62513344 CACCTCCCTCCCAGACGGGGCGG + Intronic
991373318 5:65940495-65940517 CACCTCCCTCCCAGACGGGGCGG - Intronic
991672571 5:69062904-69062926 CACCTCCCTCCGGGACGGGGCGG + Intergenic
991672595 5:69062953-69062975 CACCTCCCTCCGGGACGGGGCGG + Intergenic
991910000 5:71551786-71551808 CACCTCCCTCCCAGACGGGGTGG + Intronic
992289789 5:75270745-75270767 CACCTCCCTCCCAGATGGGGCGG - Intergenic
992289859 5:75270921-75270943 CACCTCCCTCCCAGACGGGGCGG - Intergenic
992416380 5:76556092-76556114 CAGCTTCCTCTGTAAAGGAGGGG + Intronic
992463630 5:76984758-76984780 CACCTCCCTCCCAGACGGGGCGG + Intergenic
992624531 5:78625274-78625296 CACATCCCTCTGAAAAGGCGGGG + Intronic
992852478 5:80824403-80824425 CACCTCCCTCCCAGACGGGGCGG + Intronic
992994486 5:82318983-82319005 CAGCTCCATCTGTGAAGTAGGGG + Intronic
996069917 5:119122147-119122169 CACCTCCCTCCCAGACGGGGCGG + Intronic
996070045 5:119122451-119122473 CACCTCCCTCCCAGACGGGGTGG + Intronic
996386239 5:122913308-122913330 CACCTCCCTCCCAGACGGGGCGG + Intronic
997321595 5:132983033-132983055 CACCTCCCTCTCGGAAGGGGCGG + Intergenic
997874744 5:137537762-137537784 CACCTCCCTCCCAGACGGGGCGG + Intronic
997874872 5:137538068-137538090 CACCTCCCTCCCAGACGGGGCGG + Intronic
997874891 5:137538117-137538139 CACCTCCCTCCCAGACGGGGCGG + Intronic
999181130 5:149670624-149670646 CACCTCCCTCCCAGACGGGGTGG + Intergenic
999256190 5:150211123-150211145 CAGCTCCCACTGGACAGGGGAGG + Intronic
1000032996 5:157419843-157419865 CACCTCCCTCCCAGACGGGGCGG - Intronic
1000033040 5:157419938-157419960 CACCTCCCTCCCAGACGGGGCGG - Intronic
1000055480 5:157602514-157602536 CAGCACCCTGTGGCAAGGGGTGG + Intergenic
1000103355 5:158037047-158037069 CACCTCCCTCCCAGAGGGGGCGG + Intergenic
1000103376 5:158037094-158037116 CACCTCCCTCCCAGAAGGGGCGG + Intergenic
1001077783 5:168643344-168643366 CACCTCCCTCCCGGAAGGGGCGG + Intergenic
1001416085 5:171545598-171545620 CATCCCTCTCTGAGACGGGGAGG - Intergenic
1001559775 5:172661428-172661450 CAGCTGCCTTGAAGAAGGGGTGG + Intronic
1002001218 5:176197166-176197188 CATCTCCATCTCAGAAGGAGGGG + Intergenic
1002013853 5:176305509-176305531 CACCTCCCTCCCAGACGGGGTGG - Intronic
1002098305 5:176844951-176844973 CACCGCCCTCTGATAAGGTGGGG - Intronic
1002160760 5:177312656-177312678 CAGCTTCCTCACAGAAGAGGAGG - Intronic
1002205481 5:177560106-177560128 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1002253118 5:177941801-177941823 CATCTCCATCTCAGAAGGAGGGG - Intergenic
1002605884 5:180382469-180382491 AAGCTCTCACTGAGAAGTGGAGG + Intergenic
1002688879 5:181036949-181036971 CTGCCCCTTCTGAGATGGGGCGG + Intergenic
1002938851 6:1698662-1698684 CAGCCCACTCTGAGAAGGGCAGG + Intronic
1003059069 6:2848526-2848548 CATCTCCCTCTGACTATGGGTGG - Intergenic
1003407362 6:5835719-5835741 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1004874369 6:19939547-19939569 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1004874490 6:19939820-19939842 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1004874659 6:19940278-19940300 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1004999344 6:21225071-21225093 GTGCTCCTTCTGAGCAGGGGTGG - Intronic
1005456694 6:26026876-26026898 CAGCTCTTTCTGAGAGGGAGTGG + Exonic
1005606954 6:27485421-27485443 CATCTCCCTCCCAGACGGGGTGG + Intergenic
1006029047 6:31165777-31165799 GAGCTCCCTCTGGGAAGAGGTGG - Intronic
1006039800 6:31244234-31244256 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1006064681 6:31454739-31454761 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1006128471 6:31854425-31854447 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1006148936 6:31976048-31976070 CACCTCCCTCCCAGACGGGGCGG + Intronic
1006231972 6:32595053-32595075 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1006232308 6:32595785-32595807 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1006232412 6:32596012-32596034 CACCTCCCTCTCGGATGGGGCGG + Intergenic
1006303856 6:33207739-33207761 GAGCTCCCATTGGGAAGGGGGGG - Intergenic
1006346295 6:33485746-33485768 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1006546747 6:34786844-34786866 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1006578459 6:35062697-35062719 CAGCTCCCTCTCAGAGTGGAAGG + Intronic
1006651845 6:35558048-35558070 TAGGTACCTCTGAGAAGGGACGG + Intergenic
1007403168 6:41616419-41616441 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1008621258 6:53273642-53273664 CAGCTGTCTCTGAGAGTGGGTGG - Intronic
1008624617 6:53305115-53305137 CACCTCCCTCCCAGACGGGGCGG + Intronic
1010030492 6:71266623-71266645 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1010264371 6:73851066-73851088 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1010300604 6:74255114-74255136 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1010513179 6:76744541-76744563 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1011148573 6:84244672-84244694 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1011297266 6:85838796-85838818 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1011297330 6:85838941-85838963 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1011297373 6:85839038-85839060 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1011426750 6:87239403-87239425 CACCTCCCTCCCAGACGGGGTGG + Intronic
1012032138 6:94084898-94084920 CAGCTGTCTCTAAGAGGGGGTGG - Intergenic
1012428720 6:99142224-99142246 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1012899561 6:104991195-104991217 CACCTCCCTCCCAGACGGGGTGG + Intronic
1012983673 6:105854052-105854074 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1013190876 6:107803357-107803379 CACCTCCCTCCCAGACGGGGTGG - Intronic
1013485824 6:110595198-110595220 CATGTCCTTCTGAGAAGGGTGGG - Intergenic
1013674733 6:112445266-112445288 CAGCACCCTCTGAGAAAGGGAGG - Intergenic
1014556731 6:122848557-122848579 CACCTCCCTCCGGGACGGGGCGG + Intergenic
1014557085 6:122849365-122849387 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1015070563 6:129088487-129088509 CACCTCCCTCCCAGACGGGGTGG + Intronic
1015643554 6:135363777-135363799 CACCTCCCTCCGGGACGGGGTGG + Intronic
1015819953 6:137250098-137250120 CAGCTCCCCCTGAGCTGGGCCGG + Intergenic
1017170430 6:151450429-151450451 CACCTCCCTCCCAGACGGGGTGG - Intronic
1017447899 6:154526018-154526040 CAGCTTGCTCTGAGATGGTGAGG + Intergenic
1017660665 6:156670373-156670395 CACCTCCCTCCCAGAAGGGGCGG - Intergenic
1017851333 6:158308641-158308663 CACCTCCCTCTCGGACGGGGCGG + Intronic
1018582335 6:165317822-165317844 CAGCGGCCTTTGAGAAGGGGAGG + Intergenic
1018716295 6:166535288-166535310 CAGCTCTCTCTCAGAACTGGAGG + Intronic
1018847543 6:167566094-167566116 CAGCAGCCTCTGAGCAGGAGTGG + Intergenic
1019439151 7:1038184-1038206 CACCTCCCTCCCAGATGGGGCGG - Intronic
1019458943 7:1146720-1146742 CAACTCCCTCCCAGACGGGGCGG + Intergenic
1019981385 7:4624206-4624228 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1019981407 7:4624255-4624277 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1020284633 7:6670960-6670982 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1020284727 7:6671186-6671208 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1020325957 7:6975223-6975245 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1020616345 7:10465617-10465639 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1021647470 7:22801201-22801223 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1021672280 7:23046112-23046134 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1021672465 7:23046562-23046584 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1021891927 7:25194607-25194629 CAGGAGCCTCTGAGAAGAGGAGG + Intergenic
1021991900 7:26148274-26148296 CAGCTCCCTCCCGGAGGGGGCGG - Intergenic
1021991923 7:26148321-26148343 CAGCTCCCTCCCGGAGGGGGCGG - Intergenic
1021991946 7:26148368-26148390 CAGCTCCCTCCCGGAGGGGGCGG - Intergenic
1022005481 7:26262279-26262301 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1022083399 7:27045149-27045171 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1023851356 7:44152130-44152152 CAGCTGCCTCTGAGGCTGGGTGG + Intronic
1023966397 7:44965147-44965169 CAGCTTCCTCTGTGGAGAGGGGG - Intronic
1024625874 7:51208365-51208387 CACCTCCCTCCCAGACGGGGCGG - Intronic
1024931186 7:54667740-54667762 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1024931283 7:54667962-54667984 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1024981139 7:55158707-55158729 CAGCTCCTACTGAGACAGGGTGG + Intronic
1025011642 7:55402707-55402729 CACCTCCCTCCCAGACGGGGTGG + Intronic
1025103189 7:56151305-56151327 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1025212106 7:57025735-57025757 CAGCTCCCTCTGAGAAGGGGAGG - Intergenic
1025572945 7:62599743-62599765 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1025572985 7:62599836-62599858 CACCTCCCTCCCAGATGGGGTGG + Intergenic
1025659848 7:63551093-63551115 CAGCTCCCTCTGAGAAGGGGAGG + Intergenic
1025800886 7:64785028-64785050 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1025800907 7:64785076-64785098 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1025803624 7:64809554-64809576 CACCTCCCTCCCAGATGGGGCGG + Intronic
1025803648 7:64809606-64809628 CACCTCCCTCCCAGACGGGGTGG + Intronic
1025821643 7:64968298-64968320 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1026008029 7:66614802-66614824 CACCTCCCTCCCGGAAGGGGTGG - Intergenic
1027371259 7:77509630-77509652 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1027371308 7:77509757-77509779 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1027492284 7:78843760-78843782 AAGTACCCTCTGAGAAGGGTAGG - Intronic
1028227283 7:88266218-88266240 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1029150548 7:98477394-98477416 TACCTCCCTTTGAGAAGGGGGGG - Intergenic
1029569103 7:101358988-101359010 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1029675284 7:102064490-102064512 CAGCTCCCTCTGAGAAGGGGAGG - Intronic
1030602857 7:111610287-111610309 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1031997694 7:128243419-128243441 CAGGGGTCTCTGAGAAGGGGAGG + Intronic
1032042931 7:128577100-128577122 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1032197413 7:129797419-129797441 CAGGACCCTCTGAGATTGGGAGG - Intergenic
1032220480 7:129990518-129990540 CAGCTGCCTCTCACAAGGGCAGG - Intergenic
1032569618 7:132985004-132985026 CACCTCCCTCCCAGACGGGGCGG - Intronic
1033219708 7:139520154-139520176 CACCTCCCTCCGGGACGGGGCGG + Intergenic
1034638584 7:152585816-152585838 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1034638660 7:152585992-152586014 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1034723449 7:153315138-153315160 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1035118834 7:156548099-156548121 AGGTTCCCCCTGAGAAGGGGAGG + Intergenic
1035611996 8:973211-973233 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1035764169 8:2092256-2092278 CAGTTCCCTGTGAAAAGGGCCGG + Intronic
1036536540 8:9657309-9657331 CACCTCCCTCCCAGACGGGGCGG + Intronic
1037434374 8:18847151-18847173 CAGGCCCCTCTGAAAAGGGATGG + Intronic
1038398282 8:27262917-27262939 GAACTACCTCTGAGAAGGGCAGG - Intergenic
1038715371 8:29986530-29986552 CAGCTTCCTCTGGTCAGGGGAGG - Intergenic
1039153276 8:34529098-34529120 CACCTCCCTCCCAGATGGGGTGG + Intergenic
1039153328 8:34529225-34529247 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1039650828 8:39339070-39339092 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1040069818 8:43179848-43179870 CACCTCCCTCCCAGACGGGGCGG + Intronic
1040785489 8:51159218-51159240 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1041070809 8:54125470-54125492 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1041358208 8:57022406-57022428 CACCTCCCTCCCAGATGGGGTGG - Intergenic
1041677258 8:60548779-60548801 CACCTCCCTCCCAGACGGGGCGG + Intronic
1041796378 8:61752614-61752636 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1042196153 8:66232646-66232668 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1042196196 8:66232743-66232765 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1043821477 8:84870999-84871021 CAGTTCCCTCTTAGAATGGGGGG - Intronic
1043912073 8:85875003-85875025 CAGGTCCCTCTGAGAAGCCAAGG - Intergenic
1043958488 8:86389795-86389817 CACCTCCCTCCCAGATGGGGCGG + Intronic
1043961557 8:86423907-86423929 CACCTCCCTCCCAGATGGGGCGG + Intronic
1043971318 8:86531865-86531887 TAGCTCCCTCTGAGAATGTAAGG + Intronic
1043985841 8:86694087-86694109 CACCTCCCTCCCAGACGGGGCGG + Intronic
1044259342 8:90098806-90098828 CAGCTCCAACTCAGAAGGGGTGG + Intergenic
1045298671 8:100892667-100892689 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1045439717 8:102197543-102197565 CAGTTCCCTCCGTGAAGGAGCGG + Intergenic
1047078885 8:121437133-121437155 CATCTGCCTCTGGGTAGGGGAGG - Intergenic
1047266616 8:123314869-123314891 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1047266843 8:123315407-123315429 CACCTCCCTCCAAGACGGGGCGG - Intergenic
1047266886 8:123315505-123315527 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1048368551 8:133758069-133758091 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1048445099 8:134487419-134487441 CGCATCCCTTTGAGAAGGGGTGG + Intronic
1048610036 8:136012170-136012192 CACCTCCCTCTGATAAAGGTGGG + Intergenic
1048923549 8:139251526-139251548 CACCTTGCTCTGAGAAGGGAGGG - Intergenic
1050558197 9:6807769-6807791 CACCTCCCTCCCAGACGGGGTGG - Intronic
1051138971 9:13956870-13956892 CAGCACCCTCTGAGAAATGGAGG - Intergenic
1051280931 9:15442118-15442140 CACCTCCCTCCGGGACGGGGCGG + Intronic
1051280974 9:15442210-15442232 CACCTCCCTCCGGGACGGGGCGG + Intronic
1051430573 9:16977382-16977404 CACCTCCCTCTCGGACGGGGCGG + Intergenic
1051823334 9:21192770-21192792 GAGCTCCCAGTGAGAAGGGTGGG + Intergenic
1051827137 9:21233369-21233391 GAGCTCCCAGTGAGAAGGGTGGG + Intronic
1052492610 9:29188713-29188735 CACCTCCCTCTCGGATGGGGCGG + Intergenic
1052881070 9:33601135-33601157 CACCTCCCTCTCGGACGGGGTGG - Intergenic
1052928737 9:34039169-34039191 CACCTCCCTCCCGGAAGGGGCGG - Intronic
1052951005 9:34211619-34211641 CCAGGCCCTCTGAGAAGGGGAGG - Intronic
1053312366 9:37027721-37027743 CAGCTCCCTCCGGGCGGGGGCGG + Intronic
1054910655 9:70452354-70452376 GAGCAACCTCTGAGAAGGTGAGG + Intergenic
1055640752 9:78316996-78317018 GAGCTCGCTCTGGGTAGGGGTGG + Intronic
1056152593 9:83804276-83804298 CACCTCCCTCCCAGATGGGGCGG - Intronic
1056624860 9:88245131-88245153 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1056670914 9:88626381-88626403 CACCTCCCTCCCAGATGGGGCGG - Intergenic
1057635020 9:96756699-96756721 CAGCTGCTTTTCAGAAGGGGTGG + Exonic
1060023090 9:120149139-120149161 CTGCTGCCCCTGAGAAGAGGAGG - Intergenic
1060249079 9:121971193-121971215 CACCTCCCTCCGGGACGGGGCGG - Intronic
1060687229 9:125624010-125624032 CACCTCCCTCCCAGACGGGGCGG - Intronic
1060703701 9:125780374-125780396 CACCTCCCTCCCAGACGGGGCGG + Intronic
1060703728 9:125780426-125780448 CACCTCCCTCCCAGACGGGGCGG + Intronic
1060894553 9:127209411-127209433 CACCTCCCTCTCAGAAAGAGGGG - Intronic
1061119439 9:128634221-128634243 CAGCTGCCTCTGGGAAAGGTAGG - Exonic
1061608320 9:131728707-131728729 CAGCACTCACAGAGAAGGGGAGG - Intronic
1061620310 9:131807509-131807531 CGGCTCCCTCTGGGATGGAGGGG + Intergenic
1061914867 9:133744818-133744840 CACCTCCCTCCCGGAAGGGGCGG - Intergenic
1061923404 9:133794538-133794560 GAGCTCCCTCTGGGTGGGGGAGG - Intronic
1061982973 9:134116225-134116247 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1061983598 9:134117684-134117706 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1062236977 9:135515036-135515058 CAGGTGCCACTGAGAGGGGGTGG - Intergenic
1062250241 9:135590182-135590204 CACGTCTATCTGAGAAGGGGAGG + Intergenic
1062364915 9:136203922-136203944 CAGGGCCCTCTGGGCAGGGGTGG - Intronic
1062519335 9:136951124-136951146 CAGCTACCTGTGAGGATGGGAGG + Intronic
1062713345 9:137988760-137988782 CAGCCCCCTCTGAGCACTGGGGG + Intronic
1203463929 Un_GL000220v1:68319-68341 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1203562697 Un_KI270744v1:71749-71771 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1187183665 X:16965276-16965298 CACCTCCCTCCCAGACGGGGCGG + Intronic
1187184158 X:16968530-16968552 CACCTCCCTCCGGGACGGGGTGG + Intronic
1187184207 X:16968657-16968679 CACCTCCCTCCCAGACGGGGCGG + Intronic
1187976337 X:24709027-24709049 CACCTCCCTCCCAGACGGGGCGG + Intronic
1188367588 X:29333592-29333614 CACCTCCCTCCCAGACGGGGCGG + Intronic
1188477264 X:30602702-30602724 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1189056804 X:37707269-37707291 CACCTCCCTCCCAGACGGGGCGG + Intronic
1189210354 X:39278015-39278037 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1189210427 X:39278190-39278212 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1189443173 X:41055966-41055988 GAGCTGCCCCTGGGAAGGGGTGG + Intergenic
1189569991 X:42285722-42285744 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1189570011 X:42285768-42285790 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1189837602 X:45040408-45040430 CACCTCCCTCCCAGACGGGGCGG + Intronic
1189955859 X:46275646-46275668 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1189968312 X:46395523-46395545 CACCTCCCTCCCAGATGGGGCGG + Intergenic
1189968454 X:46395846-46395868 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1190521182 X:51280274-51280296 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1190769637 X:53504255-53504277 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1190778978 X:53578332-53578354 CACCTCCCTCCCAGACGGGGTGG - Intronic
1190779180 X:53578782-53578804 CACCTCCCTCCCAGACGGGGCGG - Intronic
1191009924 X:55748762-55748784 CACCTCCCTCCCAGATGGGGCGG - Intronic
1191010047 X:55749037-55749059 CACCTCCCTCCCAGACGGGGCGG - Intronic
1191068963 X:56380252-56380274 CACCTCCCTCCCAGACGGGGCGG + Intergenic
1191068985 X:56380298-56380320 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1192026317 X:67456680-67456702 AAGCTCCCTATGCGATGGGGTGG + Intergenic
1192252215 X:69422337-69422359 CACCTCCCTCCCAGAAGGGGTGG - Intergenic
1192369952 X:70504835-70504857 CATAGCCCTCTGAGGAGGGGAGG + Exonic
1192476951 X:71452120-71452142 CACCTCCCTCCCAGACGGGGCGG + Intronic
1192530211 X:71876926-71876948 CACCTCCCTCCGGGATGGGGCGG + Intergenic
1192621213 X:72681372-72681394 CACCTCCCTCCCAGATGGGGTGG - Intronic
1192768815 X:74167208-74167230 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1192768863 X:74167306-74167328 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1193068102 X:77279558-77279580 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1193345176 X:80396913-80396935 CACCTCCCTCCCAGACGGGGCGG + Intronic
1193345227 X:80397038-80397060 CACCTCCCTCCCAGACGGGGTGG + Intronic
1193362228 X:80591276-80591298 CACCTCCCTCCGGGATGGGGTGG - Intergenic
1193362305 X:80591452-80591474 CACCTCCCTCCCAGACGGGGCGG - Intergenic
1193362329 X:80591501-80591523 CACCTCCCTCCCAGAAGGGGCGG - Intergenic
1193655200 X:84188998-84189020 CAGCCCCCTCTGAGAATGTTGGG + Intergenic
1193924406 X:87466206-87466228 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1194611480 X:96050927-96050949 CACCTCCCTCCCAGACGGGGTGG + Intergenic
1197452961 X:126641565-126641587 CACCTCCCTCTCGGACGGGGTGG - Intergenic
1197455731 X:126674149-126674171 CACCTCCCTCCCAGACGGGGTGG - Intergenic
1197616187 X:128694499-128694521 CAGCTGCCTCTCAGATGGGTGGG - Intergenic
1197736206 X:129851226-129851248 CACCTCCCTCCCGGAAGGGGCGG - Intergenic
1199452584 X:147992300-147992322 CACCTCCCTCCCAGAGGGGGCGG + Intronic
1199900101 X:152164721-152164743 CAGCTCCGTGTGAAAAGGGATGG - Intergenic
1201335811 Y:12878908-12878930 CACCTCCCTCCGGGACGGGGCGG - Intergenic
1202373314 Y:24212621-24212643 CACCAGCCTCTGGGAAGGGGAGG - Intergenic
1202497467 Y:25457499-25457521 CACCAGCCTCTGGGAAGGGGAGG + Intergenic