ID: 1025659849

View in Genome Browser
Species Human (GRCh38)
Location 7:63551094-63551116
Sequence AGCTCCCTCTGAGAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 3, 1: 0, 2: 1, 3: 25, 4: 302}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659838_1025659849 23 Left 1025659838 7:63551048-63551070 CCGTCCACTGCATGCCTTGGAGG No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659842_1025659849 9 Left 1025659842 7:63551062-63551084 CCTTGGAGGTGCAAGCCAAGGCT No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659834_1025659849 29 Left 1025659834 7:63551042-63551064 CCCAGCCCGTCCACTGCATGCCT No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659835_1025659849 28 Left 1025659835 7:63551043-63551065 CCAGCCCGTCCACTGCATGCCTT No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659837_1025659849 24 Left 1025659837 7:63551047-63551069 CCCGTCCACTGCATGCCTTGGAG No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659844_1025659849 -6 Left 1025659844 7:63551077-63551099 CCAAGGCTTGGTAACACAGCTCC No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302
1025659840_1025659849 19 Left 1025659840 7:63551052-63551074 CCACTGCATGCCTTGGAGGTGCA No data
Right 1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG 0: 3
1: 0
2: 1
3: 25
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659849 Original CRISPR AGCTCCCTCTGAGAAGGGGA GGG Intergenic
900637440 1:3672837-3672859 AGCTTCCTCTAAGAAAGGGGTGG - Intronic
900661257 1:3785167-3785189 AGATCTCTGTGAGAAGAGGACGG - Exonic
901036450 1:6338878-6338900 AGCGCCCAGTGGGAAGGGGAAGG + Intronic
902121375 1:14168961-14168983 ACCTCCCTCTGAGCAAGGCATGG + Intergenic
902449142 1:16485537-16485559 AGCTGCCCCTGAGATGGGGCAGG - Intergenic
902468535 1:16632243-16632265 AGCTGCCCCTGAGATGGGGCAGG - Intergenic
902514603 1:16983322-16983344 AGGCCCCTCTGAGGAAGGGAGGG - Intergenic
905362559 1:37430721-37430743 AGCTCCACCTGAAAAGGGCAGGG + Intergenic
905459189 1:38111259-38111281 GGCTGCCTCTTAGAAGGGGAGGG + Intergenic
905800530 1:40839566-40839588 AACTCCATCTGAGCAGGAGAAGG + Exonic
906199343 1:43949048-43949070 AGCTAAGTCTGAGAAGGGCATGG - Intronic
907320087 1:53596552-53596574 ACAGCCCTCTGCGAAGGGGATGG + Intronic
907470263 1:54669100-54669122 AGCTCCCTCTGTGTAGGTGGAGG - Intronic
907666110 1:56435053-56435075 CCCTCCTTCTGAGAAAGGGATGG - Intergenic
907827358 1:58031639-58031661 AGCTTCCTCTGAGAGGGAGAAGG - Intronic
908768218 1:67572860-67572882 AGCAGCCTCTGAGAAGGGCCGGG - Intergenic
910289833 1:85589087-85589109 CTCTTCCTCTGAAAAGGGGATGG + Intergenic
910306455 1:85769741-85769763 AGCACATTCAGAGAAGGGGAAGG - Intronic
912411887 1:109485362-109485384 AAGGCCCTCTAAGAAGGGGAGGG + Intronic
914503084 1:148264757-148264779 AGGTCGCCCTGAGAAGGGGTGGG + Intergenic
915107386 1:153542910-153542932 AGCTCCTTCAGAGAAGGACAGGG - Intergenic
915290970 1:154883090-154883112 AGCTCACTGAGAGAAGGGTAGGG - Intergenic
915309950 1:155001842-155001864 GGCTCCCTCCGAGAGGGGGTGGG + Intergenic
916080584 1:161229533-161229555 AGCTCCTTCTGGGAATGGGTGGG - Exonic
917853392 1:179083314-179083336 AGCTACCTCTCAGAGGGGGCTGG + Intronic
918253057 1:182721977-182721999 ATCTCCATCATAGAAGGGGAAGG - Intergenic
919806316 1:201382876-201382898 AGCTCCCTGGGGGAAGGGGAGGG - Intronic
919856720 1:201711272-201711294 AGCTCCCCCTGGGAGGGGAAAGG + Intronic
920111921 1:203592829-203592851 AGGCCACTCTGAGAAGAGGAGGG - Intergenic
920264618 1:204712445-204712467 ACCTCCCTGGGTGAAGGGGAGGG - Intergenic
922167868 1:223130656-223130678 AGCTCACTCTCAGAAGCAGATGG - Intronic
922732855 1:227960546-227960568 AGCTCAATTTGAGGAGGGGAAGG + Intergenic
923406526 1:233666607-233666629 ACCTCCATCTGACAAGGGCACGG - Exonic
923443412 1:234043169-234043191 AGGTCACTCTGAGGAGGGGGAGG - Intronic
923792940 1:237127425-237127447 ACCTCCCTCCCAGAAGGGGGCGG + Intronic
924804513 1:247351811-247351833 AGCTCCGTCTGAAATGGGGGAGG - Intergenic
1063843223 10:10094948-10094970 TGCTGGCTCTGGGAAGGGGAAGG + Intergenic
1066561558 10:36675144-36675166 AGCTCTCTCTGAGGAGGTGATGG - Intergenic
1067093172 10:43281741-43281763 CCCTCCCTCTGAGAAGGGACTGG - Intergenic
1067833830 10:49625716-49625738 AGCCCCCTCGGAGAAGGTAATGG - Intronic
1070168119 10:73913158-73913180 AGCCCTCTGGGAGAAGGGGATGG - Intronic
1070553217 10:77507699-77507721 AGCTCCCTCTTGAAAAGGGAAGG + Intronic
1070767583 10:79065639-79065661 AGTTTCCTCTGAAAGGGGGATGG + Intergenic
1070788161 10:79174279-79174301 AGCTCCCACTGGGAGGGGCAGGG + Intronic
1070987405 10:80700671-80700693 CTCTCTCTCTGGGAAGGGGATGG - Intergenic
1071263129 10:83939174-83939196 AGCACCCTTTAATAAGGGGAGGG - Intergenic
1071320873 10:84455739-84455761 AGTTCCCTCTGAGAATGTGCAGG - Intronic
1074367640 10:112872236-112872258 TCCTTCCTCTGAGAAGGAGATGG - Intergenic
1075122800 10:119676622-119676644 ACCTCCCTCTGAGAAGGTAGAGG + Exonic
1075556164 10:123434172-123434194 AGGTCCCTCTTAGAAAGGTACGG - Intergenic
1075740622 10:124693847-124693869 AGCTCCCTGAGAGAAGGGGCAGG + Intronic
1076188044 10:128464141-128464163 AGCTCCCTCTGACAGGGGAAGGG - Intergenic
1076562314 10:131375259-131375281 AGGTCCCTAGGAGCAGGGGATGG - Intergenic
1076655335 10:132019869-132019891 AGCTCCTGCTCAGAAGGGGCAGG + Intergenic
1076833452 10:133008333-133008355 ACCTCCCTCGGTGACGGGGAGGG + Intergenic
1077840790 11:5972589-5972611 AGCTGGCTTGGAGAAGGGGATGG - Intergenic
1078020709 11:7654074-7654096 AGCCCCCCCAGTGAAGGGGATGG + Intronic
1078836565 11:15035546-15035568 CGCTCCCACTCAGAAGGGGTGGG + Intronic
1079184851 11:18227582-18227604 AGCTCCCTCAGATATGGGGGTGG - Intronic
1080190073 11:29534683-29534705 TGCTGCCTCTGAGAATGGTAGGG - Intergenic
1080266781 11:30409379-30409401 AGCTCCCTCTGGGAAGCCCATGG + Intronic
1080902854 11:36511832-36511854 AGCTCACACTAAGAAGTGGAGGG - Intronic
1084456448 11:69270523-69270545 AACTCCCACTGAGCATGGGATGG - Intergenic
1084530828 11:69726890-69726912 AGCTCCCCACGGGAAGGGGATGG - Intergenic
1084898423 11:72292639-72292661 TGCTCAGTCTGAGTAGGGGAGGG + Exonic
1084953731 11:72680496-72680518 AGGTCCCTCTCAGATGGGGCAGG - Intergenic
1085169376 11:74435493-74435515 TGCTGTCTCTGATAAGGGGAGGG + Intergenic
1085736354 11:79042514-79042536 AGCACCATCTGAGAAGCAGAGGG + Intronic
1085754044 11:79189298-79189320 AACTGCCTCTGAAAAAGGGAAGG - Intronic
1088909996 11:114183566-114183588 AGCACCAGCTGGGAAGGGGAGGG - Intronic
1089282293 11:117382817-117382839 TGCTGCCTGTGAGAAGGGCAAGG + Exonic
1089925742 11:122255602-122255624 ATGTCCTTCTGAGAAGGTGAGGG + Intergenic
1090129189 11:124121881-124121903 AGCTGTCTCTGAGAATGGAAAGG + Intronic
1090177139 11:124660783-124660805 AGCTCACTCTGATACGTGGATGG - Exonic
1094112718 12:26878720-26878742 AGCTGCCTCTCAGAAGGGAGTGG + Intergenic
1096759686 12:53830600-53830622 GGCTGCCTATGAGAAGTGGAAGG + Intergenic
1097180844 12:57171041-57171063 GGCTATCTCTGTGAAGGGGAGGG + Intronic
1102057343 12:109906557-109906579 AGCTCCATCTGAGGATGGAAGGG - Exonic
1102471207 12:113160968-113160990 AGCTTCATCTGTGAAGTGGAAGG + Intronic
1102983252 12:117259025-117259047 AGATCCCCCTGAGAATGGGGAGG - Exonic
1103191307 12:119004450-119004472 AGCTGCTCCTGAGAGGGGGAGGG + Intronic
1103611737 12:122128154-122128176 CAGTCCCTCTGAGAAGGGGGAGG - Intronic
1104312001 12:127661841-127661863 AGCTCTCTGGGAGAAGGGAAGGG - Intergenic
1104769085 12:131349444-131349466 AGGTCCCTCGGAAAAGGGTAAGG + Intergenic
1104775039 12:131385931-131385953 AGCTCCCTCGGGGAGGGGGCGGG - Intergenic
1107868921 13:44729466-44729488 ACCTCCGTCTGAGAAGAGGCAGG + Intergenic
1108868480 13:54951195-54951217 CTTTCCCTCTGAGAATGGGAGGG - Intergenic
1111926166 13:94465041-94465063 TGATGGCTCTGAGAAGGGGAGGG - Intronic
1113579295 13:111417545-111417567 AGCTTCACCTGAGAAGGTGAAGG - Intergenic
1114737688 14:25059525-25059547 GGCACCCTCTGAGGAGGTGATGG + Intergenic
1117962229 14:61174808-61174830 AGCACCATCTGATGAGGGGAAGG + Intergenic
1119229259 14:72967705-72967727 GGCTCCCCCTGAAAAGGAGAGGG + Intergenic
1119476100 14:74930165-74930187 AGCTCTCTGTGACATGGGGAAGG - Intergenic
1121051017 14:90818954-90818976 ATCTCCCTCTGGGAAGGGGCAGG + Intergenic
1121604408 14:95230190-95230212 ATCTCCCCTTGGGAAGGGGAAGG - Intronic
1123220440 14:106850910-106850932 AGCCCCCTCAGAGAACTGGATGG + Intergenic
1124104570 15:26725355-26725377 ATGTGCCTCTGAGGAGGGGAAGG - Intronic
1124721718 15:32116428-32116450 AGGTCGCTCTGAGGAGAGGATGG + Intronic
1124941057 15:34218485-34218507 GGATCCCTCTGAGCGGGGGAGGG - Intergenic
1126112709 15:45185108-45185130 AGAACCCTCTGAGAAGGGATGGG - Intronic
1127412856 15:58726864-58726886 ATCTCCATCTCCGAAGGGGAGGG + Intronic
1127437677 15:58974052-58974074 AGCTCCCTCTGGGCAGTCGAAGG + Intronic
1128095289 15:64949630-64949652 AGCAGCCTCTCAGATGGGGAGGG - Intronic
1128802907 15:70508358-70508380 AGCTCCCTCTGGAAGGGGCAGGG + Intergenic
1128934636 15:71734857-71734879 GACTCCCTCTGGGAAGGGCATGG - Intronic
1129298678 15:74613368-74613390 AGCCTCCTCTGAGGTGGGGATGG + Intronic
1129968219 15:79755747-79755769 GGCTCCCCCTGAAAAGGAGAGGG + Intergenic
1130099139 15:80878847-80878869 ACCTCCCTCTGAGATGTGGATGG - Exonic
1130893133 15:88150218-88150240 TCCTCCCTCTGAGATGGGCAGGG - Intronic
1131529023 15:93176567-93176589 AGCGCCATCTGAGAAGGTGGTGG + Intergenic
1132870971 16:2115620-2115642 GGGTCCCTGTGAGGAGGGGAGGG + Exonic
1133040402 16:3057445-3057467 AGTGTCCTCTGAGATGGGGATGG + Intronic
1133041920 16:3065410-3065432 TGCTCCCTCTGAGCTGGGGTGGG - Exonic
1133054467 16:3138633-3138655 AGCTCCCTCTGTGAAGTCCAGGG + Intronic
1134038091 16:11047402-11047424 AACTCCCTCTGGGATGGGCAGGG - Intronic
1135759608 16:25126468-25126490 AGGCCTCTCTCAGAAGGGGATGG - Intronic
1136233934 16:28903285-28903307 AGCGCCCTCTCAGGAGGGGGTGG - Intronic
1136552586 16:30989501-30989523 TGTCCCCTCTGAGAAGGGGAGGG + Exonic
1136619111 16:31416271-31416293 AGCTCACCCTGAGAAGCTGAGGG - Exonic
1137924212 16:52524576-52524598 AGCCCTCTGTGGGAAGGGGAGGG - Intronic
1137947917 16:52751873-52751895 AGCTCCCTGTCAGAAGCAGAGGG - Intergenic
1138021100 16:53482292-53482314 ACCTCATTCTAAGAAGGGGAAGG + Intronic
1138441975 16:57040763-57040785 AGCAGGCTCTGAGCAGGGGAAGG - Intronic
1138749049 16:59396815-59396837 AGCTTCCTTTGAGAAGTGGCAGG + Intergenic
1139563504 16:67758481-67758503 AGCTCCTTTCGAGAAGGGGTTGG - Intronic
1139589790 16:67927224-67927246 ACCTCTCTCTGGAAAGGGGAGGG + Intronic
1140257209 16:73347501-73347523 ATCTACCTCTGAGAAGGGTGAGG - Intergenic
1141246177 16:82309648-82309670 AGCTTCCCTTGAGTAGGGGAGGG + Intergenic
1141277884 16:82604577-82604599 AGCTCTGTCTGAGTTGGGGAAGG + Intergenic
1141443611 16:84044717-84044739 GGCTCCTCCAGAGAAGGGGACGG + Intergenic
1141536339 16:84683349-84683371 AGCCTCCTGGGAGAAGGGGAGGG - Intergenic
1142164272 16:88577403-88577425 AGCTCCCCCTGCGAGGAGGAGGG + Exonic
1143564359 17:7712437-7712459 AGGGCCCACTGAGAAAGGGAGGG + Intergenic
1147030559 17:37631449-37631471 AGTTGCCTCTGAGCAGGGGCAGG + Intronic
1147248537 17:39138632-39138654 AGAGCCTTCTGAGAAAGGGAAGG + Intronic
1147428451 17:40357228-40357250 AGCCCCCACTGTGAAGGGGCTGG + Intronic
1147661555 17:42119711-42119733 AGCACACCCTGAGAAGGGGTGGG + Exonic
1147820743 17:43240339-43240361 AGCGCCCTCTGTGAAAGGGCGGG - Intergenic
1148323424 17:46770701-46770723 AACTCCCTCCCAGAAGGGTAGGG + Intronic
1148480278 17:47955569-47955591 AGCTCCCGCTCAGAAAGTGAAGG + Intronic
1151549485 17:74813843-74813865 AGTTCCCTCAAAAAAGGGGAAGG - Intronic
1151727763 17:75894497-75894519 AGCTCCCAGGGAGATGGGGAAGG - Intronic
1152034566 17:77864136-77864158 AGCTGCCTCTGTGAAAGTGAGGG - Intergenic
1155225511 18:23726115-23726137 AGCTCCCAAAGAGATGGGGAGGG + Intronic
1156489992 18:37490570-37490592 AGCTTCCTCTGAGCCGGGGCTGG + Intronic
1156620336 18:38844168-38844190 AGCTCCCTCTGGGAAGGGACAGG + Intergenic
1159559858 18:69982578-69982600 AGCTCCTGCAGACAAGGGGATGG + Intergenic
1160233497 18:77067213-77067235 AGCTGCCTCCCAGAAGGGGGCGG - Intronic
1160320898 18:77893715-77893737 AGCTCCTTCTGAGGGAGGGAGGG - Intergenic
1166313599 19:41976385-41976407 CGCTCCCGCAGAGGAGGGGACGG - Intronic
1166497687 19:43316089-43316111 AGTTCCATCTGAGGAGGAGAAGG + Intergenic
1166780663 19:45340918-45340940 CGCTCGCCCTGAGACGGGGAAGG + Intronic
925031732 2:655010-655032 AGTCCCCTCTGAGGAGGTGATGG + Intergenic
925168023 2:1730931-1730953 TGCTTCCTGTGAGAAGAGGAGGG + Intronic
925307529 2:2861010-2861032 AGCTCCCTCTGGGCAGGCCATGG - Intergenic
927432697 2:23040547-23040569 GGTTCCCTCTGAGCAGCGGATGG + Intergenic
930381747 2:50638575-50638597 CGCTCACTCTGAGAAGTGAATGG - Intronic
930747499 2:54900042-54900064 AGCTCTCAATGAGAAGAGGAAGG - Intronic
930891959 2:56400497-56400519 TCCTCCCTCTGGGATGGGGAAGG - Intergenic
931711852 2:64994590-64994612 ACCTCCCTCTGTGAAGGGAAAGG - Intronic
932932857 2:76062701-76062723 ATCTTCCTCTAAGAAGAGGAAGG - Intergenic
933662942 2:84942538-84942560 AGCTCCATCTGCATAGGGGAGGG + Intergenic
934201962 2:89893559-89893581 TGCTCTCTCTGAGCTGGGGAAGG - Intergenic
934504200 2:94878815-94878837 AGCTCCCTCTGAGGCTGGGGTGG - Intergenic
935728247 2:106042945-106042967 AGCTTTCTCTAAGAACGGGAAGG - Intergenic
937095388 2:119232205-119232227 AGCTGCCTCTGGGGTGGGGAGGG - Intronic
937252471 2:120533582-120533604 AGCTTCCACTATGAAGGGGAAGG - Intergenic
937786354 2:125904133-125904155 ACCTCCCTCTGAGAAGTGGTGGG + Intergenic
938317554 2:130340528-130340550 AGGTCTCTCTGAGGAGGTGAAGG - Intronic
940640035 2:156334807-156334829 TGCTCCCTCGCGGAAGGGGAAGG - Intronic
940885504 2:158986324-158986346 AGCACTCTCTCAGGAGGGGAGGG + Intronic
942973484 2:181985670-181985692 AGCTCCCTCTGAGTATTGCAGGG - Intronic
944491919 2:200266719-200266741 AACTCCCACTGAGAAGGACATGG - Intergenic
944675240 2:202030000-202030022 CTCTCCCTCTGAGAGAGGGAGGG - Intergenic
946145680 2:217729264-217729286 AGCTCCTTCTTAGAAGTGGTGGG - Intronic
946342528 2:219080128-219080150 AGATCTCTCTGAGAAGGGGAAGG - Intronic
947138250 2:226996211-226996233 AGCTGCCACTGGGAAGGGGCTGG - Exonic
947212472 2:227720773-227720795 GGATCCCACTGAGAAGAGGATGG + Intergenic
948711674 2:239829151-239829173 GGCCCCCTCTGGGAAAGGGATGG - Intergenic
948711696 2:239829215-239829237 GGCCCCCTCTGGGAAAGGGATGG - Intergenic
949037075 2:241820885-241820907 AGCACCCTCTGAGCTGGGGTTGG + Intergenic
1168923332 20:1558926-1558948 AGATTCCTCAGAGTAGGGGAAGG - Intronic
1169027556 20:2383422-2383444 AGCTCCACCTAAGAAAGGGAAGG - Intronic
1169460444 20:5790015-5790037 AGCTCTCACTCAGCAGGGGAAGG - Intronic
1170795754 20:19545561-19545583 AGGTCCCTCTGAGATAGGCATGG + Intronic
1171030000 20:21668840-21668862 AGCACCCTTGTAGAAGGGGAGGG + Intergenic
1171353271 20:24521990-24522012 AGCTGCCTCTGAGAAGTGTCTGG - Intronic
1171458053 20:25282979-25283001 AGAGCCCTCTCAGAAGAGGAAGG + Intronic
1172002371 20:31789101-31789123 TGCTCCCTCAATGAAGGGGAAGG - Intronic
1172393244 20:34580854-34580876 AGCCACCTCTGAAGAGGGGATGG + Intronic
1172596796 20:36155453-36155475 CTCTCCCTCTGATCAGGGGACGG - Intronic
1172657064 20:36543785-36543807 AGCTCCCTAGGAGAGGGGGGCGG + Intronic
1174114910 20:48220151-48220173 AGCTTCCTCAGAGAAGGAGAAGG - Intergenic
1176167468 20:63681651-63681673 AGCTGCGTCTGTGAAGGAGAAGG - Intronic
1177672386 21:24249207-24249229 AACTCAATCTGACAAGGGGATGG - Intergenic
1178698407 21:34813845-34813867 AGCTTTCTCTGAGATGGGGCTGG - Intronic
1179463135 21:41551087-41551109 AGCCCCTTCTGAGAAGAGGCCGG - Intergenic
1180188614 21:46152181-46152203 AGGGCCCTCTGAGGAGGGGGTGG - Intronic
1181533289 22:23529326-23529348 GGCTGCCTCGGAGGAGGGGAGGG + Intergenic
1182361121 22:29747089-29747111 ACCTGCCTCTGGGGAGGGGATGG + Intronic
1183628809 22:39020963-39020985 AGGTCCCTCTGCCAGGGGGAGGG + Intronic
1183632285 22:39040722-39040744 AGGTCCCTCTGCCAGGGGGAGGG + Exonic
1183638109 22:39077123-39077145 AGGTCCCTCTGCCAGGGGGAGGG + Exonic
1184236423 22:43185687-43185709 TTCTCCATCTGGGAAGGGGATGG - Intronic
1184417628 22:44361430-44361452 GGCTTCCCCTGAGAAGGGCAGGG + Intergenic
949930512 3:9074681-9074703 ACTTCCCTCAGAGATGGGGATGG - Intronic
950089694 3:10286859-10286881 AGCCCCCTTTGAGATGGGGATGG - Intronic
950236903 3:11330234-11330256 AGCTACCTTTAAGGAGGGGAAGG + Intronic
950366632 3:12490355-12490377 GGCTACCTCTGGGAACGGGATGG - Intronic
951123081 3:18951268-18951290 AACCCCCTCTGAGGAGGGTAGGG - Intergenic
952164663 3:30733892-30733914 AGCACCCCCTCAGAAGGGGGAGG - Intronic
952252264 3:31666119-31666141 AGCTTGCTCTGAGGAGGGGAGGG + Intronic
953027098 3:39151675-39151697 AACTTCCTGGGAGAAGGGGAGGG + Intronic
953381323 3:42474749-42474771 ATTTCCCTATGAGAAGGGGGTGG - Intergenic
953683212 3:45055784-45055806 TGCTCCCTGGGAGAAGGGGGTGG + Intergenic
953740852 3:45537892-45537914 AGCTCTCTCAGAGGAGGGGAAGG + Intronic
954639327 3:52088751-52088773 GGCTTGCTCTGAGAAGAGGAAGG - Intronic
955780045 3:62474926-62474948 GGCTACCTTTGAGGAGGGGAGGG + Intronic
956412774 3:68995561-68995583 AGCAGCCACAGAGAAGGGGAGGG + Intronic
957213072 3:77286011-77286033 TGTTACCTCTGAGAAGGGAATGG - Intronic
958007296 3:87828051-87828073 AGTTCCATCTGGGTAGGGGAGGG + Intergenic
958795459 3:98702302-98702324 ATCTGCCTCTGAGAAAGGCAGGG + Intergenic
959598407 3:108152434-108152456 AGCTACTTCTGATAAGGGGGAGG + Intergenic
962694136 3:137930935-137930957 AGCTCCCTGGAAGAAGGAGAAGG - Intergenic
962809159 3:138946891-138946913 CGCTCCCTAGGGGAAGGGGAAGG - Exonic
963257904 3:143164220-143164242 AAATAACTCTGAGAAGGGGAAGG - Intergenic
966035140 3:175402886-175402908 AGCTCTCTGAGAGAAGGGCAAGG + Intronic
966200103 3:177353209-177353231 AGCCCTCTCTGAGAAGGTGAGGG + Intergenic
966779597 3:183572704-183572726 AGATCTCTCTGAGAATGTGATGG - Intergenic
967097009 3:186185592-186185614 AGCTCCCTCAGAGCAGAGAAGGG - Intronic
967971983 3:195005996-195006018 GGCTTCCTCTGAGATGGGGTGGG - Intergenic
968025836 3:195442364-195442386 AGCTCCCTCAAAGAGGGGGTGGG + Intronic
968492763 4:899243-899265 AGCTCCTTCTGAGATAGGGAAGG + Intronic
968990665 4:3909389-3909411 AGCTCCCTCAGGGCAGGGGCTGG + Intergenic
969122966 4:4923342-4923364 AGCACCCTATGAGATGGGCAGGG - Intergenic
969666557 4:8560697-8560719 AGCTCCCCCTGGGAAGAGGCTGG + Intronic
969797496 4:9537337-9537359 AGCTACCACAGAGAGGGGGAGGG + Intergenic
971036038 4:22693743-22693765 AACTCCCTTTGTGGAGGGGAAGG - Intergenic
973133274 4:46674867-46674889 GGCTCCCTTTGAGAAGGAGTAGG - Intergenic
975244514 4:72104105-72104127 AGATCCCACTGGGCAGGGGATGG - Intronic
975425263 4:74217955-74217977 TACTCCATCTGAGAAGGGCATGG - Intronic
976006726 4:80439456-80439478 AGCTTCCCTTGACAAGGGGAGGG - Intronic
978146599 4:105380644-105380666 AGTTACCTCTGAGAAGGGAGGGG - Intronic
981964828 4:150587798-150587820 AGCTCTTTGTGAGGAGGGGAAGG - Intronic
982858104 4:160411200-160411222 AGCTCCATTTGAGCATGGGATGG + Intergenic
983179047 4:164625881-164625903 GGCTGACTCTGAGAAAGGGATGG - Intergenic
984694153 4:182762757-182762779 AGCTCTCTCTGGGTTGGGGAAGG + Intronic
984873025 4:184344034-184344056 AGCTCCTACAGAGAAGGGCAGGG + Intergenic
985563136 5:601990-602012 TGCTCCCTGTGAGATGGGCACGG + Intergenic
985999581 5:3619991-3620013 AACTGTCTCTGAGCAGGGGAAGG + Intergenic
987431871 5:17844871-17844893 TGCTGCCTCTAAGATGGGGAAGG - Intergenic
988553927 5:32220472-32220494 AGCTGCCTCAGAGAAGAAGAGGG + Intergenic
989230981 5:39086291-39086313 CCCTGCCTCTGAGAAGGGCAGGG - Intergenic
990456746 5:55995437-55995459 AGCTCCCTTGGGGATGGGGAAGG + Intergenic
992214887 5:74516216-74516238 AGCTCCTGCTGAGAAGGTAATGG - Intergenic
994788108 5:104188851-104188873 AACTCCCTCAGCCAAGGGGATGG + Intergenic
995705943 5:114989671-114989693 AGCTCCCTCTGCTCAGGGGGAGG + Intergenic
996757982 5:126954895-126954917 AGTTGCCTCTGGGAAGGGAAAGG - Intronic
997747265 5:136310213-136310235 GGTTCCCTCTGAGGTGGGGAGGG - Intronic
998503038 5:142650142-142650164 TGTTTCCTCTGAGAAGGAGAAGG + Intronic
999070696 5:148740498-148740520 AGATGTATCTGAGAAGGGGACGG - Intergenic
999228922 5:150050039-150050061 AGCTGTCTCTCAGAAGGGCAAGG + Intronic
1001406476 5:171480770-171480792 AGGAGCCACTGAGAAGGGGATGG - Intergenic
1001416084 5:171545597-171545619 ATCCCTCTCTGAGACGGGGAGGG - Intergenic
1002160759 5:177312655-177312677 AGCTTCCTCACAGAAGAGGAGGG - Intronic
1002605885 5:180382470-180382492 AGCTCTCACTGAGAAGTGGAGGG + Intergenic
1003117287 6:3291456-3291478 AGCTCCCTCAGACAAGTGAAAGG - Intronic
1006578460 6:35062698-35062720 AGCTCCCTCTCAGAGTGGAAGGG + Intronic
1007389079 6:41539564-41539586 AGCCCTCTGAGAGAAGGGGATGG + Intergenic
1007729734 6:43938696-43938718 AGCTGCCACTGAGGAGAGGATGG - Intergenic
1007933662 6:45714528-45714550 AGCTGGCTCTGAGAAGGGAGCGG + Intergenic
1016337522 6:143023832-143023854 GGCTCCCTGTGAGAATGGGCAGG + Intergenic
1017447900 6:154526019-154526041 AGCTTGCTCTGAGATGGTGAGGG + Intergenic
1017766769 6:157613459-157613481 AGCTCCTTCTGAGTAGGCCAAGG + Intronic
1018716296 6:166535289-166535311 AGCTCTCTCTCAGAACTGGAGGG + Intronic
1018968464 6:168507866-168507888 AGCTCACTCTGAGATGGCAAAGG + Intronic
1022275492 7:28851445-28851467 AGCTCCCTCTAAAAATGGGCTGG + Intergenic
1023559822 7:41462218-41462240 GTCTGTCTCTGAGAAGGGGAAGG + Intergenic
1025212105 7:57025734-57025756 AGCTCCCTCTGAGAAGGGGAGGG - Intergenic
1025659849 7:63551094-63551116 AGCTCCCTCTGAGAAGGGGAGGG + Intergenic
1029590342 7:101502960-101502982 AGCTCACCCTGAGAAGGAGGAGG - Intronic
1029675283 7:102064489-102064511 AGCTCCCTCTGAGAAGGGGAGGG - Intronic
1030849887 7:114470822-114470844 CTCTCCCTCGGGGAAGGGGAAGG + Intronic
1031997695 7:128243420-128243442 AGGGGTCTCTGAGAAGGGGAGGG + Intronic
1032173777 7:129607678-129607700 GGCTGCCTCTGAGAAAGGCAAGG + Intergenic
1032416204 7:131737347-131737369 TGCTGCCATTGAGAAGGGGAAGG + Intergenic
1033045973 7:137962457-137962479 AGATCCCTCAGGGAAGGGGAAGG - Intronic
1033734986 7:144213458-144213480 AGCTTCCTATGTGAATGGGAGGG + Intergenic
1033748070 7:144337511-144337533 AGCTTCCTATGTGAATGGGAGGG - Intergenic
1033990557 7:147280223-147280245 AGTTCCCTTTGAGAACGGGCTGG + Intronic
1034295582 7:149969248-149969270 AGCTCTTTCTGAGGATGGGAAGG - Intergenic
1035118835 7:156548100-156548122 GGTTCCCCCTGAGAAGGGGAGGG + Intergenic
1037890456 8:22621350-22621372 AGCTAGCCCTGAGAAGGGCAAGG + Exonic
1038192892 8:25339950-25339972 ATCTGCCTCTGAGATGGGGCTGG - Intronic
1038398281 8:27262916-27262938 AACTACCTCTGAGAAGGGCAGGG - Intergenic
1039330683 8:36533598-36533620 CGCTACCTCTGGGGAGGGGAGGG + Intergenic
1040092358 8:43410890-43410912 AACTTCCTGTGAGAATGGGAAGG + Intergenic
1041019779 8:53627155-53627177 AGCTCCCTCTGTTTGGGGGAAGG - Intergenic
1041249377 8:55919708-55919730 GCCTCCCGCTGAGAAGGGAAGGG - Intronic
1042258742 8:66834391-66834413 AGTTACCTTTGAGAAGGAGAAGG + Intronic
1043821476 8:84870998-84871020 AGTTCCCTCTTAGAATGGGGGGG - Intronic
1044259343 8:90098807-90098829 AGCTCCAACTCAGAAGGGGTGGG + Intergenic
1044399193 8:91750637-91750659 ACATCCATCTGGGAAGGGGAGGG + Intergenic
1044748996 8:95398612-95398634 AGCACCTTCAGAAAAGGGGATGG - Intergenic
1047078884 8:121437132-121437154 ATCTGCCTCTGGGTAGGGGAGGG - Intergenic
1047923199 8:129656341-129656363 GGCTACCTCTGAGAAGAGGTTGG + Intergenic
1048271515 8:133032020-133032042 AGCTCCAGCTGAGCAGGGGCTGG + Intronic
1048856958 8:138694212-138694234 AGATCCCGCTGAGCAGGAGAAGG + Intronic
1051138970 9:13956869-13956891 AGCACCCTCTGAGAAATGGAGGG - Intergenic
1055640753 9:78316997-78317019 AGCTCGCTCTGGGTAGGGGTGGG + Intronic
1057186665 9:93061005-93061027 AGCGCCCTGGGAGAAGGGCAGGG + Intronic
1060094495 9:120775504-120775526 AGCCCCCTCATAGAATGGGATGG + Intronic
1061078535 9:128356220-128356242 AGGCTCCTCTGAGGAGGGGATGG + Intronic
1061923403 9:133794537-133794559 AGCTCCCTCTGGGTGGGGGAGGG - Intronic
1203745021 Un_GL000218v1:36766-36788 AGCTCCCTCTGAGGCTGGGGTGG + Intergenic
1203565085 Un_KI270744v1:82718-82740 AGCTCCCTCTGAGGCTGGGGTGG - Intergenic
1185567532 X:1107382-1107404 AGGTCCGTCTGGGAAGGGAATGG - Intergenic
1189105426 X:38230472-38230494 AGTTCCCTATGACAAGGGGAAGG + Intronic
1189295994 X:39918257-39918279 AGGTCCCTCTGAGAGGGCAAAGG + Intergenic
1189443174 X:41055967-41055989 AGCTGCCCCTGGGAAGGGGTGGG + Intergenic
1191171544 X:57452891-57452913 AGCTGTATCTGAGAAGCGGAGGG - Intronic
1192026318 X:67456681-67456703 AGCTCCCTATGCGATGGGGTGGG + Intergenic
1192369953 X:70504836-70504858 ATAGCCCTCTGAGGAGGGGAGGG + Exonic
1193858996 X:86640580-86640602 TGCTGCCTCTGAGCTGGGGAAGG + Intronic
1194352291 X:92835150-92835172 CTCTGCCTCTGAAAAGGGGATGG + Intergenic
1195090062 X:101450302-101450324 ATCTGCCTGTGGGAAGGGGAGGG - Intronic
1196397065 X:115275894-115275916 TGCTCACTCTGAAGAGGGGAAGG - Intergenic
1197133467 X:123033141-123033163 ATCACCTTATGAGAAGGGGAAGG - Intergenic
1198408316 X:136339043-136339065 AGCTGTCTCTCAGAGGGGGATGG + Intronic
1199899271 X:152157196-152157218 AGCTCCTTCTGGGTAGGGGGAGG - Intergenic
1200660599 Y:5951888-5951910 CTCTGCCTCTGAAAAGGGGATGG + Intergenic