ID: 1025659872

View in Genome Browser
Species Human (GRCh38)
Location 7:63551240-63551262
Sequence CCGGCCCTAAATGGTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025659872_1025659881 17 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659881 7:63551280-63551302 TGTAATCCCAGCACTTCGGGAGG 0: 5020
1: 297851
2: 269720
3: 207813
4: 298339
1025659872_1025659885 26 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659885 7:63551289-63551311 AGCACTTCGGGAGGCCAAGGTGG 0: 1055
1: 58736
2: 148884
3: 159514
4: 99209
1025659872_1025659886 27 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659886 7:63551290-63551312 GCACTTCGGGAGGCCAAGGTGGG 0: 517
1: 31632
2: 134147
3: 235651
4: 217658
1025659872_1025659883 23 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659883 7:63551286-63551308 CCCAGCACTTCGGGAGGCCAAGG 0: 1516
1: 84229
2: 207075
3: 235653
4: 165178
1025659872_1025659887 30 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659887 7:63551293-63551315 CTTCGGGAGGCCAAGGTGGGAGG 0: 383
1: 22898
2: 74835
3: 155012
4: 165925
1025659872_1025659879 14 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659879 7:63551277-63551299 GCCTGTAATCCCAGCACTTCGGG 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877
1025659872_1025659878 13 Left 1025659872 7:63551240-63551262 CCCTTAAAACCATTTAGGGCCGG No data
Right 1025659878 7:63551276-63551298 TGCCTGTAATCCCAGCACTTCGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025659872 Original CRISPR CCGGCCCTAAATGGTTTTAA GGG (reversed) Intergenic
No off target data available for this crispr