ID: 1025662249

View in Genome Browser
Species Human (GRCh38)
Location 7:63563267-63563289
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025662249_1025662254 -7 Left 1025662249 7:63563267-63563289 CCACGTGATGCCACAGGTCGGGG No data
Right 1025662254 7:63563283-63563305 GTCGGGGGATGTGCCGGACTAGG No data
1025662249_1025662260 22 Left 1025662249 7:63563267-63563289 CCACGTGATGCCACAGGTCGGGG No data
Right 1025662260 7:63563312-63563334 TCCTATTGCCTTCCTGGCCCAGG No data
1025662249_1025662257 16 Left 1025662249 7:63563267-63563289 CCACGTGATGCCACAGGTCGGGG No data
Right 1025662257 7:63563306-63563328 GAGCCCTCCTATTGCCTTCCTGG No data
1025662249_1025662255 -6 Left 1025662249 7:63563267-63563289 CCACGTGATGCCACAGGTCGGGG No data
Right 1025662255 7:63563284-63563306 TCGGGGGATGTGCCGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025662249 Original CRISPR CCCCGACCTGTGGCATCACG TGG (reversed) Intergenic
No off target data available for this crispr