ID: 1025663432

View in Genome Browser
Species Human (GRCh38)
Location 7:63569153-63569175
Sequence CGCCTGGCAGGCTCTGCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025663421_1025663432 3 Left 1025663421 7:63569127-63569149 CCCTGGCCCAGCCCTGAGGAGCC No data
Right 1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG No data
1025663427_1025663432 -9 Left 1025663427 7:63569139-63569161 CCTGAGGAGCCCGCCGCCTGGCA No data
Right 1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG No data
1025663424_1025663432 -4 Left 1025663424 7:63569134-63569156 CCAGCCCTGAGGAGCCCGCCGCC No data
Right 1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG No data
1025663423_1025663432 -3 Left 1025663423 7:63569133-63569155 CCCAGCCCTGAGGAGCCCGCCGC No data
Right 1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG No data
1025663422_1025663432 2 Left 1025663422 7:63569128-63569150 CCTGGCCCAGCCCTGAGGAGCCC No data
Right 1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG No data
1025663426_1025663432 -8 Left 1025663426 7:63569138-63569160 CCCTGAGGAGCCCGCCGCCTGGC No data
Right 1025663432 7:63569153-63569175 CGCCTGGCAGGCTCTGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025663432 Original CRISPR CGCCTGGCAGGCTCTGCGCT TGG Intergenic
No off target data available for this crispr