ID: 1025665409

View in Genome Browser
Species Human (GRCh38)
Location 7:63580620-63580642
Sequence GGCAGGAGCCACAGTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025665409_1025665423 17 Left 1025665409 7:63580620-63580642 CCCTTCCCACTGTGGCTCCTGCC No data
Right 1025665423 7:63580660-63580682 AGCCCCTGGGAGGGTTCACCTGG No data
1025665409_1025665419 8 Left 1025665409 7:63580620-63580642 CCCTTCCCACTGTGGCTCCTGCC No data
Right 1025665419 7:63580651-63580673 GCCGTGCCCAGCCCCTGGGAGGG No data
1025665409_1025665418 7 Left 1025665409 7:63580620-63580642 CCCTTCCCACTGTGGCTCCTGCC No data
Right 1025665418 7:63580650-63580672 AGCCGTGCCCAGCCCCTGGGAGG No data
1025665409_1025665417 4 Left 1025665409 7:63580620-63580642 CCCTTCCCACTGTGGCTCCTGCC No data
Right 1025665417 7:63580647-63580669 AGCAGCCGTGCCCAGCCCCTGGG No data
1025665409_1025665416 3 Left 1025665409 7:63580620-63580642 CCCTTCCCACTGTGGCTCCTGCC No data
Right 1025665416 7:63580646-63580668 GAGCAGCCGTGCCCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025665409 Original CRISPR GGCAGGAGCCACAGTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr